The URL can be used to link to this page

Home My WebLink About23-25P 240 Deming Zone ChangeThe Metro Realty Management Corporation 240 Deming Street 240 Deming Street and portion of 440 Buckland Road Calvary Church of the Assemblies and Berry Patch II Associates L.P. c/o Metro, 6 Executive Drive, Suite 100 - Farmington, CT 06032 27600240 & 15300440 AA30 and GD Ben Tripp, The Metro Realty Management Corporation, 6 Executive Drive #100, Farmington, CT 06032 O 860.674.5624/M 860.978.4293, btripp@metro-realty.com.com 30 min X MAHZ Benjamin Tripp, Director of Development The Metro Realty Management Corp. Benjamin Tripp, Director of Development Berry Patch II Associates Limited PartnershipBenjamin Tripp, Agent of Owner (see attached) Calvary Church of the Assemblies 240 Deming Street 440 Buckland Road TOWN OF South Windsor, CONNECTICUT - Adjoining (100 ft) Site Address Owner Name Mailing Address Mailing City Mailing State Mailing Zip 1 440 Buckland 65700101 101 Oakland Road Gyasi Manu 101 Oakland Road South Windsor CT 06074 2 440 Buckland 37700015 15 Grandview Terrace Paul Pasqualoni Tr 15 Grandview Terrace South Windsor CT 06074 3 440 Buckland 65700175 175 Oakland Road Berry Patch III LLC 6 Executive Drive #100 Farmington CT 06032 4 240 Deming 81800020 20 Sele Drive Mark T. & Roberta L. Basile 20 Sele Drive South Windsor CT 06074 5 240 Deming 27600200 200 Deming Street South Windsor Farms Propco LLC 315 Norwood Park South Norwood MA 02062 6 440 Buckland 65700205 205 Oakland Road Berry Patch Associates L.P.6 Executive Drive #100 Farmington CT 06032 7 240 Deming 27600235 235 Deming Street Asticou Investment LLC 1744 Ellington Road South Windsor CT 06074 8 240 Deming 440 Buckland 27600240 240 Deming Street Calvary Church of the Assemblies 240 Deming Street South Windsor CT 06074 9 240 Deming 27600241 241 Deming Street Raul Cruz 241 Deming Street South Windsor CT 06074 10 240 Deming 27600247 247 Deming Street Margaret A. Glover 247 Deming Street South Windsor CT 06074 11 440 Buckland 37700025 25 Grandview Terrace Brian & Carin Faraci 25 Grandview Terrace South Windsor CT 06074 12 240 Deming 440 Buckland 27600260 260 Deming Street Loc H. & Tawny Pho 260 Deming Street South Windsor CT 06074 13 240 Deming 15300340 340 Buckland Road J Hannoush Family of South Windsor LLC 122 Elm Street Enfield CT 06082 14 240 Deming 15300350 350 Buckland Road Buckland Commons LLC 1744 Ellington Road South Windsor CT 06074 15 240 Deming 440 Buckland 15300432 432 Buckland Road KRE BSL Husky Buckland LLC PO Box 92129 Southlake TX 76092 16 440 Buckland 15300435 435 Buckland Road South Windsor Realty Co LLC 303 South Broadway, Suite 105 Tarrytown NY 10591-5422 17 240 Deming 440 Buckland 15300440 440 Buckland Road Berry Patch II Associates L.P.6 Executive Drive, Suite 100 Farmington CT 06032 18 440 Buckland 15300465 465 Buckland Road South Windsor Realty Co LLC 303 South Broadway, Suite 105 Tarrytown NY 10591-5422 19 440 Buckland 15300475 475 Buckland Road South Windsor Realty Co LLC 303 South Broadway, Suite 105 Tarrytown NY 10591-5422 20 440 Buckland 15300479 479 Buckland Road South Windsor Realty Co LLC 303 South Broadway, Suite 105 Tarrytown NY 10591-5422 21 440 Buckland 15300481 481 Buckland Road South Windsor Realty Co LLC 303 South Broadway, Suite 105 Tarrytown NY 10591-5422 22 440 Buckland 15300490 490 Buckland Road Copper Haven Properties LLC 6 Old Stone Crossing West Simsbury CT 06092 23 440 Buckland 15300498 498 Buckland Road Grillo Family Property LLC 379 Main Street South Windsor CT 06074 24 440 Buckland 15300530 530 Buckland Road American Eagle Financial Credit Union 530 Buckland Road South Windsor CT 06074 25 440 Buckland 65700069 69 Oakland Road David R. Meyers 6610 Belle Chase Court Gaithersburg MD 20882- 0000 Adjoins THE METRO REALTY MANAGEMENT CORPORATION 6 Executive Drive, Suite 100 | Farmington, CT 06032 860.674.5624 | btripp@metro-realty.com Affirmative Action / Equal Opportunity Employer May 26, 2023 Gyasi Manu 101 Oakland Road South Windsor, CT 06074 Re: Planning and Zoning Application 240 Deming Street & 440 Buckland Road (Portion) To Our Neighbor at 101 Oakland Road: In accordance with Section 8.7 of the Town of South Windsor Zoning Regulations, you are hereby notified that an application has been filed on the property abutting yours and is subject to a hearing by the Planning & Zoning Commission. The application and plans are on file with the South Windsor Planning Department. As an abutting property owner, you are invited to the hearing to ask questions and/or give comments. You may also submit written comments regarding the application prior to the hearing if you so desire. For additional information regarding the specific date this application will be heard, please contact the South Windsor Planning Department (860) 644-2511, ext. 329 or visit: www.southwindsor-ct.gov/ planning-department/ pages/ pending-and-recentlyapproved- applications. Sincerely, THE METRO REALTY MANAGEMENT CORPORATION By: __________________________________ Benjamin Tripp, Director of Development THE METRO REALTY MANAGEMENT CORPORATION 6 Executive Drive, Suite 100 | Farmington, CT 06032 860.674.5624 | btripp@metro-realty.com Affirmative Action / Equal Opportunity Employer May 26, 2023 Paul Pasqualoni Tr 15 Grandview Terrace South Windsor, CT 06074 Re: Planning and Zoning Application 240 Deming Street & 440 Buckland Road (Portion) To Our Neighbor at 15 Grandview Terrace: In accordance with Section 8.7 of the Town of South Windsor Zoning Regulations, you are hereby notified that an application has been filed on the property abutting yours and is subject to a hearing by the Planning & Zoning Commission. The application and plans are on file with the South Windsor Planning Department. As an abutting property owner, you are invited to the hearing to ask questions and/or give comments. You may also submit written comments regarding the application prior to the hearing if you so desire. For additional information regarding the specific date this application will be heard, please contact the South Windsor Planning Department (860) 644-2511, ext. 329 or visit: www.southwindsor-ct.gov/ planning-department/ pages/ pending-and-recentlyapproved- applications. Sincerely, THE METRO REALTY MANAGEMENT CORPORATION By: __________________________________ Benjamin Tripp, Director of Development THE METRO REALTY MANAGEMENT CORPORATION 6 Executive Drive, Suite 100 | Farmington, CT 06032 860.674.5624 | btripp@metro-realty.com Affirmative Action / Equal Opportunity Employer May 26, 2023 Berry Patch III LLC 6 Executive Drive #100 Farmington, CT 06032 Re: Planning and Zoning Application 240 Deming Street & 440 Buckland Road (Portion) To Our Neighbor at 175 Oakland Road: In accordance with Section 8.7 of the Town of South Windsor Zoning Regulations, you are hereby notified that an application has been filed on the property abutting yours and is subject to a hearing by the Planning & Zoning Commission. The application and plans are on file with the South Windsor Planning Department. As an abutting property owner, you are invited to the hearing to ask questions and/or give comments. You may also submit written comments regarding the application prior to the hearing if you so desire. For additional information regarding the specific date this application will be heard, please contact the South Windsor Planning Department (860) 644-2511, ext. 329 or visit: www.southwindsor-ct.gov/ planning-department/ pages/ pending-and-recentlyapproved- applications. Sincerely, THE METRO REALTY MANAGEMENT CORPORATION By: __________________________________ Benjamin Tripp, Director of Development THE METRO REALTY MANAGEMENT CORPORATION 6 Executive Drive, Suite 100 | Farmington, CT 06032 860.674.5624 | btripp@metro-realty.com Affirmative Action / Equal Opportunity Employer May 26, 2023 Mark T. & Roberta L. Basile 20 Sele Drive South Windsor, CT 06074 Re: Planning and Zoning Application 240 Deming Street & 440 Buckland Road (Portion) To Our Neighbor at 20 Sele Drive: In accordance with Section 8.7 of the Town of South Windsor Zoning Regulations, you are hereby notified that an application has been filed on the property abutting yours and is subject to a hearing by the Planning & Zoning Commission. The application and plans are on file with the South Windsor Planning Department. As an abutting property owner, you are invited to the hearing to ask questions and/or give comments. You may also submit written comments regarding the application prior to the hearing if you so desire. For additional information regarding the specific date this application will be heard, please contact the South Windsor Planning Department (860) 644-2511, ext. 329 or visit: www.southwindsor-ct.gov/ planning-department/ pages/ pending-and-recentlyapproved- applications. Sincerely, THE METRO REALTY MANAGEMENT CORPORATION By: __________________________________ Benjamin Tripp, Director of Development THE METRO REALTY MANAGEMENT CORPORATION 6 Executive Drive, Suite 100 | Farmington, CT 06032 860.674.5624 | btripp@metro-realty.com Affirmative Action / Equal Opportunity Employer May 26, 2023 South Windsor Farms Propco LLC 315 Norwood Park South Norwood, MA 02062 Re: Planning and Zoning Application 240 Deming Street & 440 Buckland Road (Portion) To Our Neighbor at 200 Deming Street: In accordance with Section 8.7 of the Town of South Windsor Zoning Regulations, you are hereby notified that an application has been filed on the property abutting yours and is subject to a hearing by the Planning & Zoning Commission. The application and plans are on file with the South Windsor Planning Department. As an abutting property owner, you are invited to the hearing to ask questions and/or give comments. You may also submit written comments regarding the application prior to the hearing if you so desire. For additional information regarding the specific date this application will be heard, please contact the South Windsor Planning Department (860) 644-2511, ext. 329 or visit: www.southwindsor-ct.gov/ planning-department/ pages/ pending-and-recentlyapproved- applications. Sincerely, THE METRO REALTY MANAGEMENT CORPORATION By: __________________________________ Benjamin Tripp, Director of Development THE METRO REALTY MANAGEMENT CORPORATION 6 Executive Drive, Suite 100 | Farmington, CT 06032 860.674.5624 | btripp@metro-realty.com Affirmative Action / Equal Opportunity Employer May 26, 2023 Berry Patch Associates L.P. 6 Executive Drive #100 Farmington, CT 06032 Re: Planning and Zoning Application 240 Deming Street & 440 Buckland Road (Portion) To Our Neighbor at 205 Oakland Road: In accordance with Section 8.7 of the Town of South Windsor Zoning Regulations, you are hereby notified that an application has been filed on the property abutting yours and is subject to a hearing by the Planning & Zoning Commission. The application and plans are on file with the South Windsor Planning Department. As an abutting property owner, you are invited to the hearing to ask questions and/or give comments. You may also submit written comments regarding the application prior to the hearing if you so desire. For additional information regarding the specific date this application will be heard, please contact the South Windsor Planning Department (860) 644-2511, ext. 329 or visit: www.southwindsor-ct.gov/ planning-department/ pages/ pending-and-recentlyapproved- applications. Sincerely, THE METRO REALTY MANAGEMENT CORPORATION By: __________________________________ Benjamin Tripp, Director of Development THE METRO REALTY MANAGEMENT CORPORATION 6 Executive Drive, Suite 100 | Farmington, CT 06032 860.674.5624 | btripp@metro-realty.com Affirmative Action / Equal Opportunity Employer May 26, 2023 Asticou Investment LLC 1744 Ellington Road South Windsor, CT 06074 Re: Planning and Zoning Application 240 Deming Street & 440 Buckland Road (Portion) To Our Neighbor at 235 Deming Street: In accordance with Section 8.7 of the Town of South Windsor Zoning Regulations, you are hereby notified that an application has been filed on the property abutting yours and is subject to a hearing by the Planning & Zoning Commission. The application and plans are on file with the South Windsor Planning Department. As an abutting property owner, you are invited to the hearing to ask questions and/or give comments. You may also submit written comments regarding the application prior to the hearing if you so desire. For additional information regarding the specific date this application will be heard, please contact the South Windsor Planning Department (860) 644-2511, ext. 329 or visit: www.southwindsor-ct.gov/ planning-department/ pages/ pending-and-recentlyapproved- applications. Sincerely, THE METRO REALTY MANAGEMENT CORPORATION By: __________________________________ Benjamin Tripp, Director of Development THE METRO REALTY MANAGEMENT CORPORATION 6 Executive Drive, Suite 100 | Farmington, CT 06032 860.674.5624 | btripp@metro-realty.com Affirmative Action / Equal Opportunity Employer May 26, 2023 Calvary Church of the Assemblies 240 Deming Street South Windsor, CT 06074 Re: Planning and Zoning Application 240 Deming Street & 440 Buckland Road (Portion) To Our Neighbor at 240 Deming Street: In accordance with Section 8.7 of the Town of South Windsor Zoning Regulations, you are hereby notified that an application has been filed on the property abutting yours and is subject to a hearing by the Planning & Zoning Commission. The application and plans are on file with the South Windsor Planning Department. As an abutting property owner, you are invited to the hearing to ask questions and/or give comments. You may also submit written comments regarding the application prior to the hearing if you so desire. For additional information regarding the specific date this application will be heard, please contact the South Windsor Planning Department (860) 644-2511, ext. 329 or visit: www.southwindsor-ct.gov/ planning-department/ pages/ pending-and-recentlyapproved- applications. Sincerely, THE METRO REALTY MANAGEMENT CORPORATION By: __________________________________ Benjamin Tripp, Director of Development THE METRO REALTY MANAGEMENT CORPORATION 6 Executive Drive, Suite 100 | Farmington, CT 06032 860.674.5624 | btripp@metro-realty.com Affirmative Action / Equal Opportunity Employer May 26, 2023 Raul Cruz 241 Deming Street South Windsor, CT 06074 Re: Planning and Zoning Application 240 Deming Street & 440 Buckland Road (Portion) To Our Neighbor at 241 Deming Street: In accordance with Section 8.7 of the Town of South Windsor Zoning Regulations, you are hereby notified that an application has been filed on the property abutting yours and is subject to a hearing by the Planning & Zoning Commission. The application and plans are on file with the South Windsor Planning Department. As an abutting property owner, you are invited to the hearing to ask questions and/or give comments. You may also submit written comments regarding the application prior to the hearing if you so desire. For additional information regarding the specific date this application will be heard, please contact the South Windsor Planning Department (860) 644-2511, ext. 329 or visit: www.southwindsor-ct.gov/ planning-department/ pages/ pending-and-recentlyapproved- applications. Sincerely, THE METRO REALTY MANAGEMENT CORPORATION By: __________________________________ Benjamin Tripp, Director of Development THE METRO REALTY MANAGEMENT CORPORATION 6 Executive Drive, Suite 100 | Farmington, CT 06032 860.674.5624 | btripp@metro-realty.com Affirmative Action / Equal Opportunity Employer May 26, 2023 Margaret A. Glover 247 Deming Street South Windsor, CT 06074 Re: Planning and Zoning Application 240 Deming Street & 440 Buckland Road (Portion) To Our Neighbor at 247 Deming Street: In accordance with Section 8.7 of the Town of South Windsor Zoning Regulations, you are hereby notified that an application has been filed on the property abutting yours and is subject to a hearing by the Planning & Zoning Commission. The application and plans are on file with the South Windsor Planning Department. As an abutting property owner, you are invited to the hearing to ask questions and/or give comments. You may also submit written comments regarding the application prior to the hearing if you so desire. For additional information regarding the specific date this application will be heard, please contact the South Windsor Planning Department (860) 644-2511, ext. 329 or visit: www.southwindsor-ct.gov/ planning-department/ pages/ pending-and-recentlyapproved- applications. Sincerely, THE METRO REALTY MANAGEMENT CORPORATION By: __________________________________ Benjamin Tripp, Director of Development THE METRO REALTY MANAGEMENT CORPORATION 6 Executive Drive, Suite 100 | Farmington, CT 06032 860.674.5624 | btripp@metro-realty.com Affirmative Action / Equal Opportunity Employer May 26, 2023 Brian & Carin Faraci 25 Grandview Terrace South Windsor, CT 06074 Re: Planning and Zoning Application 240 Deming Street & 440 Buckland Road (Portion) To Our Neighbor at 25 Grandview Terrace: In accordance with Section 8.7 of the Town of South Windsor Zoning Regulations, you are hereby notified that an application has been filed on the property abutting yours and is subject to a hearing by the Planning & Zoning Commission. The application and plans are on file with the South Windsor Planning Department. As an abutting property owner, you are invited to the hearing to ask questions and/or give comments. You may also submit written comments regarding the application prior to the hearing if you so desire. For additional information regarding the specific date this application will be heard, please contact the South Windsor Planning Department (860) 644-2511, ext. 329 or visit: www.southwindsor-ct.gov/ planning-department/ pages/ pending-and-recentlyapproved- applications. Sincerely, THE METRO REALTY MANAGEMENT CORPORATION By: __________________________________ Benjamin Tripp, Director of Development THE METRO REALTY MANAGEMENT CORPORATION 6 Executive Drive, Suite 100 | Farmington, CT 06032 860.674.5624 | btripp@metro-realty.com Affirmative Action / Equal Opportunity Employer May 26, 2023 Loc H. & Tawny Pho 260 Deming Street South Windsor, CT 06074 Re: Planning and Zoning Application 240 Deming Street & 440 Buckland Road (Portion) To Our Neighbor at 260 Deming Street: In accordance with Section 8.7 of the Town of South Windsor Zoning Regulations, you are hereby notified that an application has been filed on the property abutting yours and is subject to a hearing by the Planning & Zoning Commission. The application and plans are on file with the South Windsor Planning Department. As an abutting property owner, you are invited to the hearing to ask questions and/or give comments. You may also submit written comments regarding the application prior to the hearing if you so desire. For additional information regarding the specific date this application will be heard, please contact the South Windsor Planning Department (860) 644-2511, ext. 329 or visit: www.southwindsor-ct.gov/ planning-department/ pages/ pending-and-recentlyapproved- applications. Sincerely, THE METRO REALTY MANAGEMENT CORPORATION By: __________________________________ Benjamin Tripp, Director of Development THE METRO REALTY MANAGEMENT CORPORATION 6 Executive Drive, Suite 100 | Farmington, CT 06032 860.674.5624 | btripp@metro-realty.com Affirmative Action / Equal Opportunity Employer May 26, 2023 J Hannoush Family of South Windsor LLC 122 Elm Street Enfield, CT 06082 Re: Planning and Zoning Application 240 Deming Street & 440 Buckland Road (Portion) To Our Neighbor at 340 Buckland Road: In accordance with Section 8.7 of the Town of South Windsor Zoning Regulations, you are hereby notified that an application has been filed on the property abutting yours and is subject to a hearing by the Planning & Zoning Commission. The application and plans are on file with the South Windsor Planning Department. As an abutting property owner, you are invited to the hearing to ask questions and/or give comments. You may also submit written comments regarding the application prior to the hearing if you so desire. For additional information regarding the specific date this application will be heard, please contact the South Windsor Planning Department (860) 644-2511, ext. 329 or visit: www.southwindsor-ct.gov/ planning-department/ pages/ pending-and-recentlyapproved- applications. Sincerely, THE METRO REALTY MANAGEMENT CORPORATION By: __________________________________ Benjamin Tripp, Director of Development THE METRO REALTY MANAGEMENT CORPORATION 6 Executive Drive, Suite 100 | Farmington, CT 06032 860.674.5624 | btripp@metro-realty.com Affirmative Action / Equal Opportunity Employer May 26, 2023 Buckland Commons LLC 1744 Ellington Road South Windsor, CT 06074 Re: Planning and Zoning Application 240 Deming Street & 440 Buckland Road (Portion) To Our Neighbor at 350 Buckland Road: In accordance with Section 8.7 of the Town of South Windsor Zoning Regulations, you are hereby notified that an application has been filed on the property abutting yours and is subject to a hearing by the Planning & Zoning Commission. The application and plans are on file with the South Windsor Planning Department. As an abutting property owner, you are invited to the hearing to ask questions and/or give comments. You may also submit written comments regarding the application prior to the hearing if you so desire. For additional information regarding the specific date this application will be heard, please contact the South Windsor Planning Department (860) 644-2511, ext. 329 or visit: www.southwindsor-ct.gov/ planning-department/ pages/ pending-and-recentlyapproved- applications. Sincerely, THE METRO REALTY MANAGEMENT CORPORATION By: __________________________________ Benjamin Tripp, Director of Development THE METRO REALTY MANAGEMENT CORPORATION 6 Executive Drive, Suite 100 | Farmington, CT 06032 860.674.5624 | btripp@metro-realty.com Affirmative Action / Equal Opportunity Employer May 26, 2023 KRE BSL Husky Buckland LLC PO Box 92129 Southlake, TX 76092 Re: Planning and Zoning Application 240 Deming Street & 440 Buckland Road (Portion) To Our Neighbor at 432 Buckland Road: In accordance with Section 8.7 of the Town of South Windsor Zoning Regulations, you are hereby notified that an application has been filed on the property abutting yours and is subject to a hearing by the Planning & Zoning Commission. The application and plans are on file with the South Windsor Planning Department. As an abutting property owner, you are invited to the hearing to ask questions and/or give comments. You may also submit written comments regarding the application prior to the hearing if you so desire. For additional information regarding the specific date this application will be heard, please contact the South Windsor Planning Department (860) 644-2511, ext. 329 or visit: www.southwindsor-ct.gov/ planning-department/ pages/ pending-and-recentlyapproved- applications. Sincerely, THE METRO REALTY MANAGEMENT CORPORATION By: __________________________________ Benjamin Tripp, Director of Development THE METRO REALTY MANAGEMENT CORPORATION 6 Executive Drive, Suite 100 | Farmington, CT 06032 860.674.5624 | btripp@metro-realty.com Affirmative Action / Equal Opportunity Employer May 26, 2023 South Windsor Realty Co LLC 303 South Broadway, Suite 105 Tarrytown, NY 10591-5422 Re: Planning and Zoning Application 240 Deming Street & 440 Buckland Road (Portion) To Our Neighbor at 435 Buckland Road: In accordance with Section 8.7 of the Town of South Windsor Zoning Regulations, you are hereby notified that an application has been filed on the property abutting yours and is subject to a hearing by the Planning & Zoning Commission. The application and plans are on file with the South Windsor Planning Department. As an abutting property owner, you are invited to the hearing to ask questions and/or give comments. You may also submit written comments regarding the application prior to the hearing if you so desire. For additional information regarding the specific date this application will be heard, please contact the South Windsor Planning Department (860) 644-2511, ext. 329 or visit: www.southwindsor-ct.gov/ planning-department/ pages/ pending-and-recentlyapproved- applications. Sincerely, THE METRO REALTY MANAGEMENT CORPORATION By: __________________________________ Benjamin Tripp, Director of Development THE METRO REALTY MANAGEMENT CORPORATION 6 Executive Drive, Suite 100 | Farmington, CT 06032 860.674.5624 | btripp@metro-realty.com Affirmative Action / Equal Opportunity Employer May 26, 2023 Berry Patch II Associates L.P. 6 Executive Drive, Suite 100 Farmington, CT 06032 Re: Planning and Zoning Application 240 Deming Street & 440 Buckland Road (Portion) To Our Neighbor at 440 Buckland Road: In accordance with Section 8.7 of the Town of South Windsor Zoning Regulations, you are hereby notified that an application has been filed on the property abutting yours and is subject to a hearing by the Planning & Zoning Commission. The application and plans are on file with the South Windsor Planning Department. As an abutting property owner, you are invited to the hearing to ask questions and/or give comments. You may also submit written comments regarding the application prior to the hearing if you so desire. For additional information regarding the specific date this application will be heard, please contact the South Windsor Planning Department (860) 644-2511, ext. 329 or visit: www.southwindsor-ct.gov/ planning-department/ pages/ pending-and-recentlyapproved- applications. Sincerely, THE METRO REALTY MANAGEMENT CORPORATION By: __________________________________ Benjamin Tripp, Director of Development THE METRO REALTY MANAGEMENT CORPORATION 6 Executive Drive, Suite 100 | Farmington, CT 06032 860.674.5624 | btripp@metro-realty.com Affirmative Action / Equal Opportunity Employer May 26, 2023 South Windsor Realty Co LLC 303 South Broadway, Suite 105 Tarrytown, NY 10591-5422 Re: Planning and Zoning Application 240 Deming Street & 440 Buckland Road (Portion) To Our Neighbor at 465 Buckland Road: In accordance with Section 8.7 of the Town of South Windsor Zoning Regulations, you are hereby notified that an application has been filed on the property abutting yours and is subject to a hearing by the Planning & Zoning Commission. The application and plans are on file with the South Windsor Planning Department. As an abutting property owner, you are invited to the hearing to ask questions and/or give comments. You may also submit written comments regarding the application prior to the hearing if you so desire. For additional information regarding the specific date this application will be heard, please contact the South Windsor Planning Department (860) 644-2511, ext. 329 or visit: www.southwindsor-ct.gov/ planning-department/ pages/ pending-and-recentlyapproved- applications. Sincerely, THE METRO REALTY MANAGEMENT CORPORATION By: __________________________________ Benjamin Tripp, Director of Development THE METRO REALTY MANAGEMENT CORPORATION 6 Executive Drive, Suite 100 | Farmington, CT 06032 860.674.5624 | btripp@metro-realty.com Affirmative Action / Equal Opportunity Employer May 26, 2023 South Windsor Realty Co LLC 303 South Broadway, Suite 105 Tarrytown, NY 10591-5422 Re: Planning and Zoning Application 240 Deming Street & 440 Buckland Road (Portion) To Our Neighbor at 475 Buckland Road: In accordance with Section 8.7 of the Town of South Windsor Zoning Regulations, you are hereby notified that an application has been filed on the property abutting yours and is subject to a hearing by the Planning & Zoning Commission. The application and plans are on file with the South Windsor Planning Department. As an abutting property owner, you are invited to the hearing to ask questions and/or give comments. You may also submit written comments regarding the application prior to the hearing if you so desire. For additional information regarding the specific date this application will be heard, please contact the South Windsor Planning Department (860) 644-2511, ext. 329 or visit: www.southwindsor-ct.gov/ planning-department/ pages/ pending-and-recentlyapproved- applications. Sincerely, THE METRO REALTY MANAGEMENT CORPORATION By: __________________________________ Benjamin Tripp, Director of Development THE METRO REALTY MANAGEMENT CORPORATION 6 Executive Drive, Suite 100 | Farmington, CT 06032 860.674.5624 | btripp@metro-realty.com Affirmative Action / Equal Opportunity Employer May 26, 2023 South Windsor Realty Co LLC 303 South Broadway, Suite 105 Tarrytown, NY 10591-5422 Re: Planning and Zoning Application 240 Deming Street & 440 Buckland Road (Portion) To Our Neighbor at 479 Buckland Road: In accordance with Section 8.7 of the Town of South Windsor Zoning Regulations, you are hereby notified that an application has been filed on the property abutting yours and is subject to a hearing by the Planning & Zoning Commission. The application and plans are on file with the South Windsor Planning Department. As an abutting property owner, you are invited to the hearing to ask questions and/or give comments. You may also submit written comments regarding the application prior to the hearing if you so desire. For additional information regarding the specific date this application will be heard, please contact the South Windsor Planning Department (860) 644-2511, ext. 329 or visit: www.southwindsor-ct.gov/ planning-department/ pages/ pending-and-recentlyapproved- applications. Sincerely, THE METRO REALTY MANAGEMENT CORPORATION By: __________________________________ Benjamin Tripp, Director of Development THE METRO REALTY MANAGEMENT CORPORATION 6 Executive Drive, Suite 100 | Farmington, CT 06032 860.674.5624 | btripp@metro-realty.com Affirmative Action / Equal Opportunity Employer May 26, 2023 South Windsor Realty Co LLC 303 South Broadway, Suite 105 Tarrytown, NY 10591-5422 Re: Planning and Zoning Application 240 Deming Street & 440 Buckland Road (Portion) To Our Neighbor at 481 Buckland Road: In accordance with Section 8.7 of the Town of South Windsor Zoning Regulations, you are hereby notified that an application has been filed on the property abutting yours and is subject to a hearing by the Planning & Zoning Commission. The application and plans are on file with the South Windsor Planning Department. As an abutting property owner, you are invited to the hearing to ask questions and/or give comments. You may also submit written comments regarding the application prior to the hearing if you so desire. For additional information regarding the specific date this application will be heard, please contact the South Windsor Planning Department (860) 644-2511, ext. 329 or visit: www.southwindsor-ct.gov/ planning-department/ pages/ pending-and-recentlyapproved- applications. Sincerely, THE METRO REALTY MANAGEMENT CORPORATION By: __________________________________ Benjamin Tripp, Director of Development THE METRO REALTY MANAGEMENT CORPORATION 6 Executive Drive, Suite 100 | Farmington, CT 06032 860.674.5624 | btripp@metro-realty.com Affirmative Action / Equal Opportunity Employer May 26, 2023 Copper Haven Properties LLC 6 Old Stone Crossing West Simsbury, CT 06092 Re: Planning and Zoning Application 240 Deming Street & 440 Buckland Road (Portion) To Our Neighbor at 490 Buckland Road: In accordance with Section 8.7 of the Town of South Windsor Zoning Regulations, you are hereby notified that an application has been filed on the property abutting yours and is subject to a hearing by the Planning & Zoning Commission. The application and plans are on file with the South Windsor Planning Department. As an abutting property owner, you are invited to the hearing to ask questions and/or give comments. You may also submit written comments regarding the application prior to the hearing if you so desire. For additional information regarding the specific date this application will be heard, please contact the South Windsor Planning Department (860) 644-2511, ext. 329 or visit: www.southwindsor-ct.gov/ planning-department/ pages/ pending-and-recentlyapproved- applications. Sincerely, THE METRO REALTY MANAGEMENT CORPORATION By: __________________________________ Benjamin Tripp, Director of Development THE METRO REALTY MANAGEMENT CORPORATION 6 Executive Drive, Suite 100 | Farmington, CT 06032 860.674.5624 | btripp@metro-realty.com Affirmative Action / Equal Opportunity Employer May 26, 2023 Grillo Family Property LLC 379 Main Street South Windsor, CT 06074 Re: Planning and Zoning Application 240 Deming Street & 440 Buckland Road (Portion) To Our Neighbor at 498 Buckland Road: In accordance with Section 8.7 of the Town of South Windsor Zoning Regulations, you are hereby notified that an application has been filed on the property abutting yours and is subject to a hearing by the Planning & Zoning Commission. The application and plans are on file with the South Windsor Planning Department. As an abutting property owner, you are invited to the hearing to ask questions and/or give comments. You may also submit written comments regarding the application prior to the hearing if you so desire. For additional information regarding the specific date this application will be heard, please contact the South Windsor Planning Department (860) 644-2511, ext. 329 or visit: www.southwindsor-ct.gov/ planning-department/ pages/ pending-and-recentlyapproved- applications. Sincerely, THE METRO REALTY MANAGEMENT CORPORATION By: __________________________________ Benjamin Tripp, Director of Development THE METRO REALTY MANAGEMENT CORPORATION 6 Executive Drive, Suite 100 | Farmington, CT 06032 860.674.5624 | btripp@metro-realty.com Affirmative Action / Equal Opportunity Employer May 26, 2023 American Eagle Financial Credit Union 530 Buckland Road South Windsor, CT 06074 Re: Planning and Zoning Application 240 Deming Street & 440 Buckland Road (Portion) To Our Neighbor at 530 Buckland Road: In accordance with Section 8.7 of the Town of South Windsor Zoning Regulations, you are hereby notified that an application has been filed on the property abutting yours and is subject to a hearing by the Planning & Zoning Commission. The application and plans are on file with the South Windsor Planning Department. As an abutting property owner, you are invited to the hearing to ask questions and/or give comments. You may also submit written comments regarding the application prior to the hearing if you so desire. For additional information regarding the specific date this application will be heard, please contact the South Windsor Planning Department (860) 644-2511, ext. 329 or visit: www.southwindsor-ct.gov/ planning-department/ pages/ pending-and-recentlyapproved- applications. Sincerely, THE METRO REALTY MANAGEMENT CORPORATION By: __________________________________ Benjamin Tripp, Director of Development THE METRO REALTY MANAGEMENT CORPORATION 6 Executive Drive, Suite 100 | Farmington, CT 06032 860.674.5624 | btripp@metro-realty.com Affirmative Action / Equal Opportunity Employer May 26, 2023 David R. Meyers 6610 Belle Chase Court Gaithersburg, MD 20882- 0000 Re: Planning and Zoning Application 240 Deming Street & 440 Buckland Road (Portion) To Our Neighbor at 69 Oakland Road: In accordance with Section 8.7 of the Town of South Windsor Zoning Regulations, you are hereby notified that an application has been filed on the property abutting yours and is subject to a hearing by the Planning & Zoning Commission. The application and plans are on file with the South Windsor Planning Department. As an abutting property owner, you are invited to the hearing to ask questions and/or give comments. You may also submit written comments regarding the application prior to the hearing if you so desire. For additional information regarding the specific date this application will be heard, please contact the South Windsor Planning Department (860) 644-2511, ext. 329 or visit: www.southwindsor-ct.gov/ planning-department/ pages/ pending-and-recentlyapproved- applications. Sincerely, THE METRO REALTY MANAGEMENT CORPORATION By: __________________________________ Benjamin Tripp, Director of Development THE METRO REALTY MANAGEMENT CORPORATION 6 Executive Drive, Suite 100 | Farmington, CT 06032 www.metro-realty.com Affirmative Action / Equal Opportunity Employer May 24, 2023 Planning and Zoning Commission Town of South Windsor 1540 Sullivan Avenue South Windsor, CT 06074 Re: 240 Deming Street – Proposed zone change from Buckland Road Gateway Development Zone (“GD”) to Multifamily Assisted Housing Zone (“MAHZ”) Dear Chairman Pacekonis and Honorable Members of the Commission: The Metro Realty Management Corporation (“Applicant”), the contract owner of 240 Deming Street in South Windsor, Connecticut (the “Property”), hereby files an application to rezone a portion of the Property, as well as a portion of the adjacent 440 Buckland Road (“Berry Patch II”), from GD to MAHZ for the proposed development of mixed-income housing that meets the definition of “assisted housing” under Connecticut General Statutes 8- 30g. In accordance with Section 7.22.2 A. of the South Windsor Zoning Regulations, included with this application is a conceptual plan of the proposed development that shows the general layout of the site, along with coverage calculations, yard requirements, parking, and traffic circulation to demonstrate that the concept is feasible within the requirements of the MAHZ regulation. Specific details, including but not limited to final grading and drainage calculations, full landscaping and buffering plan, the number and screening of dumpsters, etc., are not included in this concept plan. If the zone change is approved, Applicant will return with a fully engineered site plan to seek special exception and site plan approval. Currently, the Property consists of 5.96 acres and two zones – approximately 4.82 acres are currently zoned GD, and approximately 1.14 acres are currently zoned AA-30. Applicant is proposing to leave the AA-30 zoning in place and rezone only the GD portion of the Property. Additionally, a portion of Berry Patch II totaling approximately 0.36 acres (which is also currently zoned GD) is proposed to be rezoned to MAHZ. Berry Patch II is owned by an affiliate entity of the Applicant. If this zone change is approved, it will be conditioned upon a future to a lot line modification between the Property and Berry Patch II, as well as a future resubdivision of the AA-30 component of the Property, so that new property lines will correspond to the new zone boundaries. We look forward to presenting support for this proposed zone change at a public hearing on the soonest available date. Sincerely, The Metro Realty Management Corporation By: __________________________________ Benjamin Tripp, Director of Development STREET 131 136.96 22 2 9 6 .5 9 11 9 150.00375.5816 103.90139.05WINTERBERRY LANE (PRIVATE)257.87118 9 WATER 518.78650.81119.61 3 22.41176 (S)350.008 159.49 1 1 8 .4 7 219.59368.5 150.03 17 171.42 2 653.7293.90415.0020 17 65.39137 1 7 322.0090.005 52.42146.91 150.00 195.00105.532157.86 124 122 7 135 7 276.97141.707 150.00429.99216.185 19 250.02 141112 410.11 215.63C O M M U NIT Y 621.52200.00 293.051 228.72 1 BUILDING 18 129 3 55.65 DEMING STREET 16 16 100.00 124.41400.0 LANE 2 115 8 186.0015 152.189 17 309.35 7 88.58 2430.30134 2 209.20415.00377.242 133 14 140.51 1 92.94 158.14260.31106 BUILDING 107 10 102.00 143 BUILDING 50.00 11 316.58125.61211.03376.44 5 3 2 9 . 8 1 100.00 138 5 13 210 (S)38.45162.58 79.05 15275.014 10 305.0015 130 340.973 140.57 11343.1612 195.0015 19 81.68 165.00 45.45188.23120 8.95 18 29.54 34 (S) 293.73 150.00 252.11 38.76 110 12 266.31 114 3275.0109.9370.51 160.03 116.6743.49 FARMBROOK 103.59 17 71.19236.05113 7 33.69155.00 19 1195 (S)8 345.00105.00158.9890.00240.3512 4 200.0014 105.00 621.72 2 6 618 20 6 3 43.1096.97 132.19 200.006 194.54246.27 2 150.00 96.63 165.61147.12111 147.46490.36 3 290.52 114.68 18 355.512 142 108.86 139 2 100.00 217.13 103.05 179.8224.56211.42B UILDIN G BUILDING SELE DRIVE12 17 128 14 2 192 (S) DEMING 20 195.0038.76 237.42 9 2 4 3 .7 9272.46119 171.951 34.57 GRANDVIEW12 3 5.60 32.02BUCKLAND ROADBARBERRY5 19 66.83 2 105 125.36 13 278.14 8 13 250.00 10 248.91 20 FA R M 185.0 180.29 BERRY FARM DEMING STREET 4 3 134.02(PRIVATE)19 LEASE LI N E 1 125 116 4 38.766 SUMMIT DRIVE293.55 176.82118.878 50.72109 83.1210 97.09 14 2 2 1 .5 4 TERRACE123 21 138.76 3 DEMING STREET 4146.906.52 121 16 LANE 200.00210.00104 179.989 150.00 6200.016 11 4 435.28 4 2 . 4 8 311.01 18 3 6 .0 6 136200.0126 WINTERBERRY 203 100.00 204.00 816.56 142.95140 13 15 195.75150.00 8 (PRIVATE)174.4299.2883.87 150.33 1 4 132 4 117 1 13 7 216.28 158.00 448.59BUILDING 108 70.00 120 (S)200.0910 451.5 100.00 373.523 150.00 230.00 164.04 1 6 224.0 9 3 5 38.76 210.0234 127 11 BUCKLAND ROAD9 8 75 3925 25 33 40 32 45 35 20 15 36 67 83 68 76 28 130 435435435 340 175 175 419 350 175 175 176 175 247 240 435 467 260 340 250 175175 350 225 175 340 435112 175 325 333 152 340 175175 285 343 235 315 296 175 175 338 112 432 324 175 241 340 175 326 175 301 152 335 312 195 112 300 112 2002701 2800 1251 26002600 2800 1000 2400 2600 2400 µ1 inch = 200 feet The information on this map is from a computer database accessed using a Geographic Information System (GIS). This is not a surveyproduct. The data provided on this map are provided for informationaland planning purposes only. The Town makes no claims or guaranteesabout the accuracy or currency of the contents of this map and expresslydisclaims liability for errors and omissions in its contents. Unauthorizedattempts to modify any information shown on this map or utilize thismap for other than its intended purposes are prohibited. Each user of thismap is responsible for determining its suitability for his or her intendeduse or purpose. In no event will the Town of South Windsor be liable forany damages, including loss of data, lost profits, business interruption,loss of business information or other pecuniary loss that might arise fromthe use of this map or the information it contains. Appl 23-25P 240 Deming Street D esignrofessionals©····· · · SITEGD38-26GD51-33GD51-32GD27-15-10-10RC38-1AA-3038-22-8AA-3038-3AA-30AA-3038-15AA-30AA-3038-24-2AA-3039-53-1AA-30AA-3052-92GD38-2500'RC51-34-2GD38-5-A38-16-227-15--1538-25-327-15-127-15--227-15-7-A27-15--11GD38-2727-15-7-F27-15--1427-15-7-B27-15-3-CM27-15-1638-5-BAA-3038-27-127-15-7BUCKLAND ROADDEMING STREETSELE DRIVEDEMING STREETGRANDVIEW TERRRACEDEMING STREETOAKLAND STREET EXISTING ZONES: GDPROPOSED ZONE: MAHZ±5.2 ACRESBUCKLAND ROADAPPROXIMATE EXISTINGBUILDING OUTLINE (TYP.)GD51-3238-2260152544020543244041939520024024028533235247241340350100010005090010002800270124003510120020FUTURE PROPERTY LINE(TYP.)SHEET NAMEDATEZCPROJECT NO.DESIGNEDRYESCALEDRAWNLCDCHECKEDTDSWNE13571.000691"=100'ZONE CHANGE MAPDESCRIPTIONBYDATEPROPERTY LINESRYE05/23/20230'50'100'01/2"1"Copyright SLR International Corporation - 2021LOCATION MAP:0'500'1000'SCALE 1" = 1000'01/2"1"KEY:38-2 PARCEL NO.240 LOCATION ADDRESSGD ZONING DISTRICT99 REALTY DRIVECHESHIRE, CT 06410203.271.1773SLRCONSULTING.COMMAY 10, 2023MAP NOTE:INFORMATION COMPILED FROM AVAILABLE TOWN OFSOUTH WINDSOR GIS INFORMATION ON MAY 2, 2023AND SHOULD BE CONSIDERED APPROXIMATE.ZONING DISTRICTSAA-30 LIMITED RESIDENTIALGD GATEWAY DEVELOPMENTMAHZ MULTI-FAMILY ASSISTED HOUSING RESIDENTIAL/COMMERCIALRC RESTRICTED COMMERCIALRR RURAL RESIDENTIALSOUTH WINDSOR, CONNECTICUTMULTI-FAMILY DEVELOPMENT 240 DEMING STREET SITEGD38-26GD51-33GD51-32GD27-15-10-10RC38-1AA-3038-22-8AA-3038-3AA-30AA-3038-15AA-30AA-3038-24-2AA-3039-53-1AA-30AA-3052-92GD38-2500'RC51-34-2GD38-5-A38-16-227-15--1538-25-327-15-127-15--227-15-7-A27-15--11GD38-2727-15-7-F27-15--1427-15-7-B27-15-3-CM27-15-1638-5-BAA-3038-27-127-15-7BUCKLAND ROADDEMING STREETSELE DRIVEDEMING STREETGRANDVIEW TERRRACEDEMING STREETOAKLAND STREET EXISTING ZONES: GDPROPOSED ZONE: MAHZ±5.2 ACRESBUCKLAND ROADAPPROXIMATE EXISTINGBUILDING OUTLINE (TYP.)GD51-3238-2260152544020543244041939520024024028533235247241340350100010005090010002800270124003510120020FUTURE PROPERTY LINE(TYP.)SHEET NAMEDATEZCPROJECT NO.DESIGNEDRYESCALEDRAWNLCDCHECKEDTDSWNE13571.000691"=100'ZONE CHANGE MAPDESCRIPTIONBYDATEPROPERTY LINESRYE05/23/20230'50'100'01/2"1"Copyright SLR International Corporation - 2021LOCATION MAP:0'500'1000'SCALE 1" = 1000'01/2"1"KEY:38-2 PARCEL NO.240 LOCATION ADDRESSGD ZONING DISTRICT99 REALTY DRIVECHESHIRE, CT 06410203.271.1773SLRCONSULTING.COMMAY 10, 2023MAP NOTE:INFORMATION COMPILED FROM AVAILABLE TOWN OFSOUTH WINDSOR GIS INFORMATION ON MAY 2, 2023AND SHOULD BE CONSIDERED APPROXIMATE.ZONING DISTRICTSAA-30 LIMITED RESIDENTIALGD GATEWAY DEVELOPMENTMAHZ MULTI-FAMILY ASSISTED HOUSING RESIDENTIAL/COMMERCIALRC RESTRICTED COMMERCIALRR RURAL RESIDENTIALSOUTH WINDSOR, CONNECTICUTMULTI-FAMILY DEVELOPMENT 240 DEMING STREET This Drawing Produced by the U.S. Access Board This Drawing Produced by the U.S. Access Board This Drawing Produced by the U.S. Access Board This Drawing Produced by the U.S. Access Board This Drawing Produced by the U.S. Access Board This Drawing Produced by the U.S. Access Board This Drawing Produced by the U.S. Access Board AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA22'24'20'8'20'20'22'20'6'8'8'50'25'25'25'GAZEBOPATIO/DECK (TYP.)DUMPSTERPAD (TYP.)PROPOSED BUS SHELTER50'PROPOSEDCONSERVATIONEASEMENT LINEPROPOSED CONSERVATIONRESTRICTION AREA± 1.14 AC2 STORY(12 UNIT)BUILDING2 STORY(12 UNIT)BUILDING2 STORY(12 UNIT)BUILDING2 STORY(12 UNIT)BUILDING2 STORY(8 UNIT)BUILDING2 STORY(8 UNIT)BUILDING2 STORY(8 UNIT)BUILDINGSTORM WATERBASIN686712768113101065ABCDFGE10777DEMING STREET9'10'8'8'SITESHEET NAMEDATELAPROJECT NO.DESIGNEDRYESCALEDRAWNLCDCHECKEDRYEMAY 12, 202313571.000691"=40'PRELIMINARY SITE PLANSOUTH WINDSOR, CONNECTICUTMULTI-FAMILY DEVELOPMENT 240 DEMING STREETSHEET NO.DESCRIPTIONBYDATE0'20'40'01/2"1"Copyright SLR International Corporation - 2021SWNE99 REALTY DRIVECHESHIRE, CT 06410203.271.1773SLRCONSULTING.COMREQUIREMENTREQ'D/PERMITTEDPROVIDEDMINIMUMTOTAL LOT AREA (S.F., AC.)174240 (4 AC.)275,515 (6.324 AC.)*FRONT YARD (FT.)5050SIDE YARD (FT.)2525 / 50REAR YARD (FT.)2525MAXIMUMBUILDING HEIGHT (FT.)3529'-1"BUILDING COVERAGE (%)1514IMPERVIOUS COVERAGE (%)5040ZONING DATA TABLEREQUIREMENTREQ'D/PERMITTEDPROPOSEDTOTAL SPACES108 SPACES136 SPACESHANDICAP SPACES5 SPACES6 SPACESREQUIRED PARKING TABLELOCATION MAP:0'500'1000'SCALE 1" = 1000'01/2"1"LOCATION MAP:0'500'1000'SCALE 1" = 1000'01/2"1"LOCATION MAP:0'500'1000'SCALE 1" = 1000'01/2"1"*INCLUDES 1.13 AC TO BE PLACED INTO CONSERVATION This Drawing Produced by the U.S. Access Board This Drawing Produced by the U.S. Access Board This Drawing Produced by the U.S. Access Board This Drawing Produced by the U.S. Access Board This Drawing Produced by the U.S. Access Board This Drawing Produced by the U.S. Access Board This Drawing Produced by the U.S. Access Board AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA22'24'20'8'20'20'22'20'6'8'8'50'25'25'25'GAZEBOPATIO/DECK (TYP.)DUMPSTERPAD (TYP.)PROPOSED BUS SHELTER50'PROPOSEDCONSERVATIONEASEMENT LINEPROPOSED CONSERVATIONRESTRICTION AREA± 1.14 AC2 STORY(12 UNIT)BUILDING2 STORY(12 UNIT)BUILDING2 STORY (12 UNIT) BUILDING2 STORY(12 UNIT)BUILDING2 STORY(8 UNIT)BUILDING2 STORY(8 UNIT)BUILDING2 STORY(8 UNIT)BUILDINGSTORM WATERBASIN686712768113101065ABCDFGE10777DEMING STREET9'10'8'8'SITESHEET NAMEDATELAPROJECT NO.DESIGNEDRYESCALEDRAWNLCDCHECKEDRYEMAY 12, 202313571.000691"=40'PRELIMINARY SITE PLANSOUTH WINDSOR, CONNECTICUTMULTI-FAMILY DEVELOPMENT 240 DEMING STREETSHEET NO.DESCRIPTIONBYDATE0'20' 40'0 1/2"1"Copyright SLR International Corporation - 2021SWNE99 REALTY DRIVECHESHIRE, CT 06410203.271.1773SLRCONSULTING.COMREQUIREMENTREQ'D/PERMITTEDPROVIDEDMINIMUMTOTAL LOT AREA (S.F., AC.) 174240 (4 AC.) 275,515 (6.324 AC.)*FRONT YARD (FT.)5050SIDE YARD (FT.)2525 / 50REAR YARD (FT.)2525MAXIMUMBUILDING HEIGHT (FT.)3529'-1"BUILDING COVERAGE (%)1514IMPERVIOUS COVERAGE (%)5040ZONING DATA TABLEREQUIREMENTREQ'D/PERMITTEDPROPOSEDTOTAL SPACES108 SPACES136 SPACESHANDICAP SPACES5 SPACES6 SPACESREQUIRED PARKING TABLELOCATION MAP:0'500' 1000'SCALE 1" = 1000'0 1/2"1"LOCATION MAP:0'500' 1000'SCALE 1" = 1000'0 1/2"1"LOCATION MAP:0'500' 1000'SCALE 1" = 1000'0 1/2"1"*INCLUDES 1.13 AC TO BE PLACED INTO CONSERVATION This Drawing Produced by the U.S. Access Board This Drawing Produced by the U.S. Access Board This Drawing Produced by the U.S. Access Board This Drawing Produced by the U.S. Access Board This Drawing Produced by the U.S. Access Board This Drawing Produced by the U.S. Access Board This Drawing Produced by the U.S. Access Board AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA22'24'20'8'20'20'22'20'6'8'8'50'25'25'25'GAZEBOPATIO/DECK (TYP.)DUMPSTERPAD (TYP.)PROPOSED BUS SHELTER50'PROPOSEDCONSERVATIONEASEMENT LINEPROPOSED CONSERVATIONRESTRICTION AREA± 1.14 AC2 STORY(12 UNIT)BUILDING2 STORY(12 UNIT)BUILDING2 STORY(12 UNIT)BUILDING2 STORY(12 UNIT)BUILDING2 STORY(8 UNIT)BUILDING2 STORY(8 UNIT)BUILDING2 STORY(8 UNIT)BUILDINGSTORM WATERBASIN686712768113101065ABCDFGE10777DEMING STREET9'10'8'8'SITESHEET NAMEDATELAPROJECT NO.DESIGNEDRYESCALEDRAWNLCDCHECKEDRYEMAY 12, 202313571.000691"=40'PRELIMINARY SITE PLANSOUTH WINDSOR, CONNECTICUTMULTI-FAMILY DEVELOPMENT 240 DEMING STREETSHEET NO.DESCRIPTIONBYDATE0'20'40'01/2"1"Copyright SLR International Corporation - 2021SWNE99 REALTY DRIVECHESHIRE, CT 06410203.271.1773SLRCONSULTING.COMREQUIREMENTREQ'D/PERMITTEDPROVIDEDMINIMUMTOTAL LOT AREA (S.F., AC.)174240 (4 AC.)275,515 (6.324 AC.)*FRONT YARD (FT.)5050SIDE YARD (FT.)2525 / 50REAR YARD (FT.)2525MAXIMUMBUILDING HEIGHT (FT.)3529'-1"BUILDING COVERAGE (%)1514IMPERVIOUS COVERAGE (%)5040ZONING DATA TABLEREQUIREMENTREQ'D/PERMITTEDPROPOSEDTOTAL SPACES108 SPACES136 SPACESHANDICAP SPACES5 SPACES6 SPACESREQUIRED PARKING TABLELOCATION MAP:0'500'1000'SCALE 1" = 1000'01/2"1"LOCATION MAP:0'500'1000'SCALE 1" = 1000'01/2"1"LOCATION MAP:0'500'1000'SCALE 1" = 1000'01/2"1"*INCLUDES 1.13 AC TO BE PLACED INTO CONSERVATION PLANNING DEPARMENT IN-HOUSE REFERRAL FORM DATE: 5-26-23 TO: Michael Maniscalco, Walter Summers, Jeff Doolittle, Molly Keays, Melissa Pierce, Kevin Cooney, Tony Manfre, John Caldwell, Andrea Confrancesco, Vincent Stetson, David Gesualdi, Marc Melanson FROM: Michele Lipe, AICP, Director of Planning The Planning & Engineering Departments have received plans for the following projects: Appl 23-25P Metro Realty Management Group Location: 240 Deming Street Site Plan (concept) Subdivision No. Acres +/- 5 ac Zone MAHZ Industrial Commercial Residential No. Lots/Units 78 Water: Public Private Well Sewerage: Public Septic System Zone change to Multi Family for “Assisted Housing” Project Description: Future Town-owned property involved? Yes No new street(s) new detention area new open space/recreation area active passive Planning Department notes: 78 apartments – Not age restricted (similar to 175 Oakland Road) Please comment by 6-16-23 and return to the Planning Department. 20230453.A10 Traffic Impact Study 240 Deming Street South Windsor, Connecticut June 2023 Town of South Windsor Land Use Applications 146 Hartford Road Manchester, CT 06040 Prepared for: Metro Realty, Ltd. 6 Executive Drive Farmington, CT 06032 \\private\DFS\ProjectData\P2023\0453\A10\Traffic\TIS\TRAFFIC IMPACT STUDY.docx i Table of Contents Traffic Impact Study 240 Deming Street South Windsor, Connecticut Summary Sheet .......................................................................................................iii 1 Introduction .................................................................................................. 1 2 Existing Condition ........................................................................................ 1 2.1 Site of Development .............................................................................................. 1 2.2 Adjacent Roadway Network .................................................................................. 1 2.3 Study Area Intersections ....................................................................................... 2 2.4 Traffic Volumes, Speeds and Counts .................................................................... 2 3 Background Traffic Conditions ................................................................... 3 3.1 Growth Rate .......................................................................................................... 3 3.2 Other Developments ............................................................................................. 3 4 Proposed Conditions ................................................................................... 3 4.1 Development ......................................................................................................... 3 4.2 Site Access and Circulation ................................................................................... 3 4.3 Trip Generation ..................................................................................................... 4 4.4 Trip Distribution ................................................................................................... 4 4.5 Combined Volumes ............................................................................................... 5 5 Analyses ....................................................................................................... 5 5.1 Crash Analysis ....................................................................................................... 5 5.2 Intersection Sight Distance Analysis .................................................................... 6 5.3 Intersection Capacity Analysis .............................................................................. 6 5.4 Queue Analysis ...................................................................................................... 7 6 Conclusions & Recommendations ............................................................. 8 \\private\DFS\ProjectData\P2023\0453\A10\Traffic\TIS\TRAFFIC IMPACT STUDY.docx ii Table of Contents (continued) Traffic Impact Study 240 Deming Street South Windsor, Connecticut Appendices End of Report Appendix A - Tables 1. Peak Hour Site Generated Traffic Volumes (Proposed Residential Use) 2. Peak Hour Site Generated Traffic Volumes (Allowable Medical Office Use Comparison) 3. Peak Hour Site Generated Traffic Volumes (Allowable Mixed Commercial Use Comparison) 4. Intersection Crash Data Summary 5. Unsignalized Intersection Level of Service Summary 6. Signalized Intersection Level of Service Summary 7. Weekday Morning Peak Hour Queue Length Summary 8. Weekday Afternoon Peak Hour Queue Length Summary 9. Saturday Peak Hour Queue Length Summary Appendix B - Figures 1. Site Location Map 2. 2025 Baseline Traffic Volumes 3. Other Generators – Evergreen Walk Expansion – Retail to Supermarket 4. 2025 Background Traffic Volumes 5. Trip Distribution 6. Trip Generation 7. 2025 Combined Traffic Volumes Appendix C Intersection Capacity Analysis Worksheets – Weekday Morning Peak Hour Appendix D Intersection Capacity Analysis Worksheets – Weekday Afternoon Peak Hour Appendix E Intersection Capacity Analysis Worksheets – Saturday Peak Hour Appendix F Turning Movement Count (TMC) Data Appendix G Crash Data Records \\private\DFS\ProjectData\P2023\0453\A10\Traffic\TIS\TRAFFIC IMPACT STUDY.docx iii Summary Sheet As an aid to reviewers, this Summary Sheet has been included to outline the various study parameters utilized in this report. Although a full explanation of the study methodologies is included in the text of the report, this summary can serve as a useful reference for reviewers. Applicant: Metro Realty, Ltd. Site Acreage: 6.3 Acres Development Size/Type: 72 apartment units Parking: 136 parking spaces including 6 accessible spaces Applications: Town of South Windsor Land Use Applications Build Year: 2025 Background Traffic Growth Factor: 1% Traffic Counts: NE Traffic Counts – 06/13/2023 (Turning Movement Counts) Peak Hours Analyzed: Morning Peak Hour – 8:00AM to 9:00AM Afternoon Peak Hour – 4:00PM to 5:00PM Saturday Peak Hour – 11:45AM to 12:45PM Expected Trip Generation: Morning Peak Hour – 25 (7 entering, 18 exiting) Afternoon Peak Hour – 28 (17 entering, 11 exiting) Saturday Peak Hour – 28 (14 entering, 14 exiting) Capacity Analysis: Technique – Highway Capacity Manual 6th Edition Execution – Synchro and SimTraffic Professional Software, Version 11.0 \\private\DFS\ProjectData\P2023\0453\A10\Traffic\TIS\TRAFFIC IMPACT STUDY.docx 1 1 Introduction Metro Realty, Ltd. proposes to construct 72 apartment units at 240 Deming Street in South Windsor, Connecticut as shown on the site location map, Figure No.1 of Appendix B. The existing site is currently occupied by the Calvary Church and surface level parking. The existing church will be demolished to accommodate the proposed residential development and the site access driveway will be reconstructed in approximately the same location as the existing driveway. Fuss & O’Neill has been retained to study the impact of the proposed development on traffic conditions throughout the adjacent roadway network. This report has been prepared to document the findings of the study and is being submitted to the Town of South Windsor Planning and Zoning Commission in support of the project’s land use applications. 2 Existing Condition 2.1 Site of Development The existing property is currently occupied by the Calvary Church which is no longer in operation. There are currently 50 surface parking spaces on the property. The site is accessible through a driveway entrance on Deming Street approximately 530 feet east of the intersection of Buckland Road and Deming Street. The site is also accessible via a sidewalk on Deming Street for pedestrians. The site is neighbored by The Residence at South Windsor Farms to the west, the Village at Buckland Court to the north, Deming Street to the south, and the Berry Patch community as well as a residential home at 260 Deming Street to the east. 2.2 Adjacent Roadway Network The adjacent roadway network consists of the following roadways: Deming Street is an east/west, town-owned, roadway that stretches approximately two and one-half miles between Clark Street to the west and Tolland Turnpike (Route 30) to the east. In the area of the site, Deming Street provides one travel lane in each direction plus turn lanes at the driveway to Evergreen Walk and at the Buckland Road intersection. From its intersection with Clark Street to its intersection with Buckland Road, Deming Street is classified by the CTDOT as an urban minor arterial roadway. East of its intersection with Buckland Road to its terminus, Deming Street is classified as an urban local roadway that provides access to land primarily zoned for commercial and residential uses. The posted speed limit of the roadway is 25 miles per hour for its entire length. Buckland Road is a north/south, town-owned, roadway that stretches approximately one and one quarter mile between Sullivan Avenue (Route 194) to the north and Buckland Street in Manchester in the south. Buckland Road carries two lanes of travel in each direction with sidewalks on both sides of the street in the vicinity of the site. The roadway widens for turn lanes at signalized intersections. This roadway is classified by CTDOT as an urban minor arterial roadway, providing access to land generally \\private\DFS\ProjectData\P2023\0453\A10\Traffic\TIS\TRAFFIC IMPACT STUDY.docx 2 zoned for commercial and residential uses. The posted speed limit of the roadway is 40 miles per hour for its entire length. 2.3 Study Area Intersections The following study area intersections were reviewed: • Deming Street and the Existing Church Site Access Driveway • Buckland Road and Deming Street Deming Street and the Existing Church Site Access Driveway is an unsignalized intersection that provides eastbound and westbound approaches onto Deming Street. The site access driveway is a southbound approach onto Deming Street. The Deming Street approaches to the intersection provide one lane of travel in each direction with a sidewalk along the north side of Deming Street. There are no traffic control signs at the intersection. Buckland Road and Deming Street is a four-way signalized intersection with Buckland Road providing the northbound and southbound approaches and Deming Street providing the eastbound and westbound approaches. Buckland Road provides one shared through/right turn lane, one dedicated through lane, and one dedicated left turn lane in both the northbound and southbound approaches. The eastbound approach on Deming Street offers one dedicated left turn lane, one dedicated through lane, and one dedicated right turn lane. The westbound direction on Deming Street offers a two-lane approach at this intersection, a dedicated left turn lane and a shared through/right turn lane. Each approach provides sidewalks and crosswalk connections throughout the intersection in addition to an exclusive pedestrian phase. 2.4 Traffic Volumes, Speeds and Counts The greatest potential for traffic impact on the roadway network by the proposed residential development will occur during the weekday morning, weekday afternoon, and Saturday peak hours which are the periods when commuter and surrounding retail related trips are at their highest levels. In order to determine the traffic impact of the proposed development on adjacent street traffic, representatives of Fuss & O’Neill, Inc. conducted peak hour manual turning movement counts (TMC’s) on Friday, June 02, 2023, and Saturday, June 03, 2023 at the Buckland Road and Deming Street intersection in the study area. The traffic count data collected indicates that the weekday morning peak hour of traffic is 8:00AM to 9:00AM, the weekday afternoon peak hour is 4:00PM to 5:00PM, and Saturday peak hour is 11:45AM to 12:45AM. These peak hours were subsequently analyzed for impacts. \\private\DFS\ProjectData\P2023\0453\A10\Traffic\TIS\TRAFFIC IMPACT STUDY.docx 3 3 Background Traffic Conditions 3.1 Growth Rate Upon consultation with the Connecticut Department of Transportation (CTDOT) the 2023 existing traffic volumes were projected to the 2025 design year using a 1.0 percent per year peak hour growth factor to account for normal traffic growth in the study area. These grown (baseline) volumes for the 2025 design year peak hours are shown in Figure No. 2 of Appendix B. 3.2 Other Developments Fuss & O’Neill contacted the Connecticut Department of Transportation (CTDOT) Bureau of Policy and Planning Office to identify any other pending or approved developments having site related traffic in the study area. There is a proposed redevelopment of the northern portion of The Promenade Shops at Evergreen Walk in South Windsor, Connecticut. The proposed building will be a 40,000 square foot grocer and an adjacent 10,000 square foot retail space that will include associated parking improvements, loading area, and the reconfiguration of the Evergreen Way. This redevelopment is substantially complete and anticipated to be operational later in 2023. Traffic volumes for this expansion/change of use at Evergreen Walk (shown in Figure No. 3 of Appendix B) were added to the grown 2025 traffic volumes to obtain the 2025 Background traffic volumes which are defined as design year traffic without the proposed residential development. These projected Background traffic volumes are shown in Figure No. 4 of Appendix B. 4 Proposed Conditions 4.1 Development Metro Realty Ltd. Proposes to construct a multi-family development of 72 total dwelling units at 240 Deming Street in South Windsor, Connecticut as shown on the site location map, Figure No.1 of Appendix B. There will be a total of 7 buildings with 3 buildings that that will house 8 units and 4 buildings that that will house 12 units. All 7 proposed buildings are 2 story buildings. A total of 136 parking spaces, including 6 accessible parking spaces, will be provided on site. The development is expected to be completed and fully occupied in 2025. 4.2 Site Access and Circulation Access to the site will be provided by one full-access driveway located on Deming Street. The driveway will be located approximately 530 feet away from the intersection of Buckland Road and Deming Street in approximately the same location as the existing church driveway. The driveway is proposed to be expanded to a 20-foot-wide entrance lane and 20-foot-wide exit lane each with an 8-foot median. The radii are proposed to be increased to accommodate larger vehicle turns into and out of the driveway and to improve safety at the intersection with Deming Street. In addition, there is a proposed bus shelter that will be located on the exit side of the driveway. The proposed bus shelter will be accessible to \\private\DFS\ProjectData\P2023\0453\A10\Traffic\TIS\TRAFFIC IMPACT STUDY.docx 4 pedestrians through the existing sidewalk that runs along the north side of Deming Street and adjacent to the proposed site development. Internal traffic circulation through the site will be accommodated by a 24-foot wide circulating drive around the parking lot. 4.3 Trip Generation The expected site generated traffic data was calculated using existing empirical data from the Institute of Transportation Engineers (ITE) publication Trip Generation, 11th edition, 2021. This publication is an industry-accepted resource for determining trip generation. Trip generation for the weekday morning, weekday afternoon, and Saturday peak hour was calculated using the ITE land use code 221, “Multifamily Housing (Mid-Rise)". A 72 dwelling unit development is expected to generate a total of only 25 trips (7 entering, 18 exiting) in the morning weekday peak hour, 28 trips (17 entering, 11 exiting) in the afternoon weekday peak hour, and 28 trips (14 entering, 14 exiting) in the Saturday peak hour. A summary of the peak hour trip generation information for the proposed development is provided in Table 1 of Appendix A. In comparison to other allowable land uses that could feasibly be constructed on the site in this zone, the proposed residential development would generate substantially less traffic. Trip generation for a medical office use was calculated by using the ITE land use code 720 “Medical-Dental Office Building”. A 61,200 square foot medical office building on this site would generate a total of 229 trips (135 entering, 94 exiting) in the weekday morning peak hour, 293 trips (117 entering, 176 exiting) in the weekday afternoon peak hour, and 185 trips (105 entering, 80 exiting) in the Saturday peak hour. A summary of the peak hour trip generation information for medical office use is provided in Table 2 of Appendix A. Trip generation for a mixed-use development on this site that includes a quick service restaurant (QSR), a sit-down restaurant, and coffee shop was calculated by using the following ITE land use codes: 932 “High-Turnover Sit-Down Restaurant”, 934 “Fast-Food Restaurant with Drive-Through”, and 936 “Coffee/Donut Shop without Drive-Through”. This 12,500 square foot mixed use development on this site would generate a total of 507 trips (266 entering, 241 exiting) in the weekday morning peak hour, 365 trips (186 entering, 180 exiting) in the weekday afternoon peak hour, and 407 trips (205 entering, 202 exiting) in the Saturday peak hour. A summary of the peak hour trip generation information for this type of mixed-use development is provided in Table 3 of Appendix A. As noted above, the proposed multifamily residential development will be a de minimis traffic generator and would produce hundreds of fewer trips than a medical office use or mixed retail use that are allowed by zoning and could feasibly be constructed on this site. 4.4 Trip Distribution The distribution of traffic entering and exiting the proposed site was applied to the road network based on the existing regional traffic distributions and the layout of the adjacent roadway network. During the peak hours, the following arrival distributions of traffic are anticipated: \\private\DFS\ProjectData\P2023\0453\A10\Traffic\TIS\TRAFFIC IMPACT STUDY.docx 5 • 40% from Buckland Road from the south • 30% from Buckland Road from the north • 15% from Deming Street from the west • 15% from Deming Street from the east A regional arrival/departure distribution for the new site generated traffic traveling to and from the project site is shown in Figure No. 5 of Appendix B. 4.5 Combined Volumes The site generated traffic was distributed to the roadway system based on the arrival/departure distributions with the results shown in Figure No. 6 of Appendix B. These volumes were then added to the background volumes to yield the year 2025 peak hour Combined traffic volumes shown in Figure No. 7 of Appendix B. 5 Analyses 5.1 Crash Analysis Crash data was gathered from the UCONN Crash Repository for the following intersections: • Buckland Road and Deming Street • Deming Street and the Existing Site Access Driveway The records were gathered for the most recent 3 years of available data, 2020 through 2022. A summary of the crash data per intersection is provided in Table 4 of Appendix A. Copies of the crash data records have been provided in Appendix F. The intersection of Buckland Road and Deming Street experienced an average of over 6 crashes per year between 2020 and 2022. Most crashes at this intersection were front to rear crashes for a total of 10 out of the 19 crashes. These crash patterns and frequencies are not abnormal for a signalized arterial intersection of this size. Of all the vehicles reported in a collision, 15 vehicles were traveling southbound, 12 vehicles were traveling northbound, 5 were traveling eastbound, and 5 were traveling westbound. Over 50 percent of all reported crashes were property damage only. The intersection of Deming Street and the existing site access driveway has not had any reported crashes in the most recent 3 years of data collected between 2020 and 2022. The type and frequency of crashes reported at the study area intersections are not considered abnormal for the traffic volumes and geometric characteristics of the study intersections. \\private\DFS\ProjectData\P2023\0453\A10\Traffic\TIS\TRAFFIC IMPACT STUDY.docx 6 5.2 Intersection Sight Distance Analysis Intersection sight distances were measured at the proposed site driveway location in accordance with criteria set forth in the 2003 CTDOT Highway Design Manual. Using the CTDOT Highway Design Manual it was determined that the intersection sight distance required at the proposed site access driveway is 320 feet for passenger cars and 420 feet for single-unit trucks. These distances correlate with a design speed of 30 miles per hour which is 5 miles per hour above the posted speed limit of 25 miles per hour currently on Deming Street. Field measurements confirmed that greater than 420 feet of intersection sight distance is available looking both left and right from the proposed site driveway location. Therefore, the sight distances will exceed CTDOT criteria for safe egress from the site driveway. 5.3 Intersection Capacity Analysis Capacity analyses for both signalized and unsignalized intersections were conducted using Synchro Professional Software, version 11.0. In discussing intersection capacity analyses results, two terms are used to describe the operating condition of the road or intersection. These two terms are volume to capacity ratio (v/c) and level of service (LOS). The v/c ratio is a ratio of the volume of traffic using an intersection to the total capacity of the intersection (the maximum number of vehicles that can utilize the intersection during an hour). The v/c ratio can be used to describe the percentage of capacity utilized by a single intersection movement, a combination of movements, an entire intersection approach, or the intersection as a whole. LOS is a measure of the delay experienced by stopped vehicles at an intersection. LOS is rated on a scale from A to F, with A describing a condition of very low delay (less than 10 seconds per vehicle), and F describing a condition where delays will exceed 50 seconds per vehicle for unsignalized intersections and 80 seconds per vehicle for signalized intersections. Delay is described as a measure of driver discomfort, frustration, fuel consumption, and lost travel time. Therefore, intersections with longer delay times are less acceptable to most drivers. LOS is generally used to describe the operation (based on delay time) of both signalized and unsignalized intersections, while v/c ratio is applied to signalized intersections only. These definitions for v/c ratio and LOS, as well as the methodology for conducting signalized and unsignalized intersection capacity analyses, are taken from the “Highway Capacity Manual 6th Edition” published by the Transportation Research Board. In discussing two-way stop controlled unsignalized intersection capacity analyses, LOS is used to provide a description of the delay and operational characteristics of the turns from the minor street (stop sign controlled) to the major street and turns from the major street to the minor street. Through \\private\DFS\ProjectData\P2023\0453\A10\Traffic\TIS\TRAFFIC IMPACT STUDY.docx 7 vehicles are not delayed by the minor street and do not experience delay, therefore they are not rated with a level of service. Using the above referenced methodologies, weekday morning, weekday afternoon, and Saturday peak hour capacity analyses were conducted at the following signalized intersection: • Buckland Road at Deming Street Weekday morning, weekday afternoon, and Saturday peak hour capacity analyses were also conducted at the following unsignalized intersection: • Deming Street at the Proposed Site Driveway Tables No. 5 and 6 of Appendix A present a summary of the levels of service at the unsignalized and signalized intersections, for both Background and Combined Conditions traffic volumes. Copies of the analysis worksheets can be found in Appendices C and D, for the weekday morning, weekday afternoon, and Saturday peak hours respectively. The determination of the traffic impact from the proposed development is made through a comparison of the Background Conditions LOS (without the proposed residential development) versus the Combined Conditions LOS (with the proposed residential development). The signalized intersection of Buckland Road and Deming Street operates acceptably at a LOS B during the weekday morning and Saturday peak hours for both Background and Combined conditions. During the weekday afternoon peak hour, the intersection operates acceptably at LOS C for both Background and Combined conditions. There will be no reduction in LOS at this intersection as a result of the proposed residential development traffic. The unsignalized intersection of Deming Street and the site access driveway operates efficiently at LOS A for the Deming Street westbound and eastbound approaches in the Combined conditions. The southbound site driveway approach to the intersection operates efficiently at LOS A during the weekday morning peak hour and LOS B during the weekday afternoon and Saturday peak hours in the Combined condition. 5.4 Queue Analysis Background and Combined Condition 95th percentile (design) queue lengths were reviewed at each intersection in the study area. The 95th percentile (design) vehicle queue lengths represent the maximum queue lengths that can be expected at each of the critical approach lanes of the study area intersections. The queue lengths are provided in the Synchro capacity analysis worksheets, which are located in Appendix C and D. Tables 5 and 6 of Appendix A provide a summary of the queue lengths for the critical lanes at each intersection. \\private\DFS\ProjectData\P2023\0453\A10\Traffic\TIS\TRAFFIC IMPACT STUDY.docx 8 During the weekday morning, weekday afternoon, and Saturday peak hours, the 95th percentile queue lengths at the unsignalized Deming Street at site driveway intersection is expected to be less than one vehicle length exiting the site and turning left into the site from the eastbound approach. During the weekday morning, weekday afternoon, and Saturday peak hours, the 95th percentile queue lengths at the signalized intersection of Buckland and Deming Street are expected to increase by less than one vehicle length during all peak hours. The design queue lengths in the combined condition can be accommodated in the available storage at each of the intersection approach lanes. 6 Conclusions & Recommendations The purpose of preparing a Traffic Impact Study is to identify the impact of the proposed residential development’s site generated traffic. The study efforts have indicated that the proposed development will generate 25 new entering and exiting trips in the weekday morning peak hour, 28 new entering and exiting trips in the weekday afternoon peak hour, and 28 new entering and exiting trips in the Saturday peak hour. These de minimis site generated traffic volumes from the proposed residential development are substantially lower than many other land uses that are allowable by zoning and could feasibly be constructed on site. Capacity analysis revealed that the unsignalized site access driveway will operate acceptably in the combined condition for weekday morning, weekday afternoon, and Saturday peak hours. The southbound site access driveway approach will experience efficient LOS A operations during the weekday morning peak hour and LOS B operations during the weekday afternoon and Saturday peak hours. Additionally, the signalized intersection of Buckland Road at Deming Street will operate acceptably at LOS B in the weekday morning peak hour and Saturday peak hour, and LOS C in the weekday afternoon peak hour for both background and combined conditions. There will be no reduction in LOS at this intersection as a result of the proposed residential development traffic. The 95th percentile queue lengths for all movements at the three study area intersections are expected to increase by no more than one vehicle length as a result of the site generated traffic. The design queue lengths in the combined condition can be accommodated in the available storage at each of the intersection approach lanes. The location of the site driveway provides sufficient intersection sight distance for vehicles exiting the development in both directions. Intersection sight distances from the proposed driveway location exceed the minimum sight distances required by CTDOT for safe egress from the site driveway. A review of the crash data provided by the UConn Crash Repository Database indicated that there were no abnormal crash patterns or frequencies in the study area. No crashes were reported on Deming Street at or near the existing site access driveway of the development in the past three years. \\private\DFS\ProjectData\P2023\0453\A10\Traffic\TIS\TRAFFIC IMPACT STUDY.docx 9 Based on the results of the foregoing analysis, it is the professional opinion of Fuss & O'Neill, Inc. that the proposed residential development will not have a significant impact to traffic operations within the study area. \\private\DFS\ProjectData\P2023\0453\A10\Traffic\TIS\TRAFFIC IMPACT STUDY.docx Appendix A Tables \\private\DFS\ProjectData\P2023\0453\A10\Traffic\TIS\TRAFFIC IMPACT STUDY.docx Table 1 Peak Hour Site Generated Traffic Volumes Proposed Residential Use 240 Deming Street South Windsor, CT 72 Dwelling Units Total Trips Trips Entering Trips Exiting Morning Weekday Peak Hour 25 7 18 Afternoon Weekday Peak Hour 28 17 11 Saturday Peak Hour 28 14 14 Note: Trip generation based on Rate per Land use Code 221 (Multifamily Housing (Mid-rise)), as published in Trip Generation, 11th Edition, 2021. Table 2 Peak Hour Site Generated Traffic Volumes Allowable Medical Office Use Comparison 240 Deming Street South Windsor, CT Medical Office 61,200 Sq. Ft Total Trips Trips Entering Trips Exiting Morning Weekday Peak Hour 229 135 94 Afternoon Weekday Peak Hour 293 117 176 Saturday Peak Hour 185 105 80 Note: Trip generation based on Rate per Land use Code 720 (Medical-Dental Office Building), as published in Trip Generation, 11th Edition, 2021. \\private\DFS\ProjectData\P2023\0453\A10\Traffic\TIS\TRAFFIC IMPACT STUDY.docx Table 3 Peak Hour Site Generated Traffic Volumes Allowable Mixed Commercial Use Comparison 240 Deming Street South Windsor, CT QSR, Sit-down Restaurant, and Coffee Shop 12,500 Sq. Ft Total Trips Trips Entering Trips Exiting Morning Weekday Peak Hour 507 266 241 Afternoon Weekday Peak Hour 365 186 180 Saturday Peak Hour 407 205 202 Note: Trip generation based on Rate per Land use Code 932 (Fast Food Restaurant with Drive-Through), 934 (High-Turnover (Sit-Down) Restaurant), 936 (Coffee/Donut Shop without Drive-Through) as published in Trip Generation, 11th Edition, 2021. \\private\DFS\ProjectData\P2023\0453\A10\Traffic\TIS\TRAFFIC IMPACT STUDY.docx Table 4 Intersection Crash Data Summary 240 Deming Street South Windsor, CT Intersections Crashes Per Year 2020 2021 2022 Average/Year Buckland Road and Deming Street 4* 8 7 6 Deming Street and the Existing Site Access Driveway 0 0 0 0 *Values indicated are number of crashes within 200 feet of each intersection during time period shown. Data provided by the UCONN Crash Repository \\private\DFS\ProjectData\P2023\0453\A10\Traffic\TIS\TRAFFIC IMPACT STUDY.docx Table 5 Unsignalized Intersection Level Of Service Summary 240 Deming Street South Windsor, CT Unsignalized Intersection (Critical Movements) 2025 Weekday Morning Peak Hour 2025 Weekday Afternoon Peak Hour 2025 Saturday Peak Hour Background Combined Background Combined Background Combined Deming Street and the Site Access Driveway Eastbound Deming Street Left LOS A* LOS A LOS A LOS A LOS A LOS A Southbound Driveway Left N/A LOS A N/A LOS B N/A LOS B Southbound Driveway Right N/A LOS A N/A LOS B N/A LOS B *Values indicated are critical movement Level of Service (LOS) \\private\DFS\ProjectData\P2023\0453\A10\Traffic\TIS\TRAFFIC IMPACT STUDY.docx Table 6 Signalized Intersection Level of Service Summary 240 Deming Street South Windsor, CT Signalized Intersections 2025 Weekday Morning Peak Hour 2025 Weekday Afternoon Peak Hour 2025 Saturday Peak Hour Background Combined Background Combined Background Combined Buckland Road and Deming Street 0.37/LOS B* 0.38/LOS B 0.61/LOS C 0.62/LOS C 0.54/LOS B 0.55/LOS B *Values indicated are intersection v/c Ratio/LOS \\private\DFS\ProjectData\P2023\0453\A10\Traffic\TIS\TRAFFIC IMPACT STUDY.docx Table 7 Weekday Morning Peak Hour Queue Length Summary 240 Deming Street South Windsor, CT Intersection Approach Lane 2025 Background Queue 2025 Combined Queue Available Storage Buckland Road and Deming Street EB Left EB Through/ EB Right WB Left WB Through/Right NB Left NB Through/Right SB Left SB Through/Right 30 Feet 50 Feet 0 Feet 35 Feet 50 Feet 25 Feet 90 Feet 10 Feet 155 Feet 30 Feet 50 Feet 0 Feet 40 Feet 55 Feet 25 Feet 95 Feet 10 Feet 155 Feet 150 Feet - 385 Feet 130 Feet - 150 Feet - 300 Feet - Deming Street and the Site Access Driveway EB Through/Left SB Left/Right N/A N/A 0 Feet 5 Feet - - NOTE: Values indicated represent 95th percentile (design) vehicle queue lengths. Values are rounded to the nearest 5 feet. \\private\DFS\ProjectData\P2023\0453\A10\Traffic\TIS\TRAFFIC IMPACT STUDY.docx Table 8 Weekday Afternoon Peak Hour Queue Length Summary 240 Deming Street South Windsor, CT Intersection Approach Lane 2025 Background Queue 2025 Combined Queue Available Storage Buckland Road and Deming Street EB Left EB Through EB Right WB Left WB Through/Right NB Left NB Through/Right SB Left SB Through/Right 55 Feet 60 Feet 0 Feet 100 Feet 120 Feet 35 Feet 215 Feet 20 Feet 300 Feet 55 Feet 60 Feet 0 Feet 100 Feet 125 Feet 35 Feet 220 Feet 20 Feet 300 Feet 150 Feet - 385 Feet 130 Feet - 150 Feet - 300 Feet - Deming Street and the Site Access Driveway EB Through/Left SB Left/Right N/A N/A 0 Feet 5 Feet - - NOTE: Values indicated represent 95th percentile (design) vehicle queue lengths. Values are rounded to the nearest 5 feet. \\private\DFS\ProjectData\P2023\0453\A10\Traffic\TIS\TRAFFIC IMPACT STUDY.docx Table 9 Saturday Peak Hour Queue Length Summary 240 Deming Street South Windsor, CT Intersection Approach Lane 2025 Background Queue 2025 Combined Queue Available Storage Buckland Road and Deming Street EB Left EB Through EB Right WB Left WB Through/Right NB Left NB Through/Right SB Left SB Through/Right 70 Feet 65 Feet 0 Feet 75 Feet 110 Feet 30 Feet 170 Feet 20 Feet 245 Feet 70 Feet 65 Feet 0 Feet 80 Feet 115 Feet 30 Feet 170 Feet 20 Feet 250 Feet 150 Feet - 385 Feet 130 Feet - 150 Feet - 300 Feet - Deming Street and the Site Access Driveway EB Through/Left SB Left/Right N/A N/A 0 Feet 5 Feet - - NOTE: Values indicated represent 95th percentile (design) vehicle queue lengths. Values are rounded to the nearest 5 feet. \\private\DFS\ProjectData\P2023\0453\A10\Traffic\TIS\TRAFFIC IMPACT STUDY.docx Appendix B Figures BUCKL A N D HILLS ROADELLINGTON GulleyFarmBrookAVENUEELLINGTON OA K L A N D SITE LOCATION D E M I N G S T BUCKLAND RDMANCH E S T E R T O W N L I N E SOUTH W I N D S O R T O W N L I N E PROJ. No.: DATE:MS VIEW: LAYER STATE: SCALE: DATUM: VERT.: HORZ.: VERT.: HORZ.:File Path: J:\DWG\P2023\0453\A10\Civil\Plan\20230453.A10_LOC01.dwg Layout: FIG1 LOC Plotted: Wed, June 21, 2023 - 3:28 PM User: jfloresPlotter: DWG TO PDF.PC3 CTB File: FO.STBFIGURE 1 20230453.A10 JUNE 2023METRO REALTY LTD. MULTIFAMILY DEVELOPMENT 240 DEMING STREET SOUTH WINDSOR CONNECTICUT 1" = 1000' 146 HARTFORD ROAD MANCHESTER, CONNECTICUT 06040 860.646.2469 www.fando.com DEMING STREETBUCKLAND ROAD240 DEMING STREET DEVELOPMENT SITE DRIVEWAYXX(XX)[XX] = WEEKDAY MORNING PEAK HOUR (WEEKDAY PM PEAK HOUR) [SATURDAY PEAK HOUR] 146 HARTFORD ROAD MANCHESTER, CONNECTICUT 06040 860.646.2469 www.fando.com FIGURE 2: 2025 BASELINE TRAFFIC VOLUMES File Path: J:\DWG\P2023\0453\A10\Civil\Plan\20230453A10_TVF01.dwg Layout: FIG 2. 2025 BASELINE Plotted: Thu, June 22, 2023 - 3:42 PM User: TYLER RUDOLPHJUNE 2023PROJ. NO: 20230453.A10 240 DEMING STREET - SOUTH WINSOR, CT XX(XX)[XX] = WEEKDAY MORNING PEAK HOUR (WEEKDAY PM PEAK HOUR) [SATURDAY PEAK HOUR] DEMING STREETBUCKLAND ROAD240 DEMING STREET DEVELOPMENT SITE DRIVEWAY146 HARTFORD ROAD MANCHESTER, CONNECTICUT 06040 860.646.2469 www.fando.com FIGURE 3: OTHER GENERATORS - EVERGREEN WALK File Path: J:\DWG\P2023\0453\A10\Civil\Plan\20230453A10_TVF01.dwg Layout: FIG 3. OTHER GEN - EVERGREEN Plotted: Thu, June 22, 2023 - 3:42 PM User: TYLER RUDOLPHJUNE 2023PROJ. NO: 20230453.A10 240 DEMING STREET - SOUTH WINDSOR, CT XX(XX)[XX] = WEEKDAY MORNING PEAK HOUR (WEEKDAY PM PEAK HOUR) [SATURDAY PEAK HOUR] DEMING STREETBUCKLAND ROAD240 DEMING STREET DEVELOPMENT SITE DRIVEWAY146 HARTFORD ROAD MANCHESTER, CONNECTICUT 06040 860.646.2469 www.fando.com FIGURE 4: 2025 BACKGROUND TRAFFIC VOLUMES File Path: J:\DWG\P2023\0453\A10\Civil\Plan\20230453A10_TVF01.dwg Layout: FIG 4. 2025 BACKGROUND Plotted: Thu, June 22, 2023 - 3:42 PM User: TYLER RUDOLPHJUNE 2023PROJ. NO: 20230453.A10 240 DEMING STREET - SOUTH WINDSOR, CT XX(XX) = ENTERING TRAFFIC (EXITING TRAFFIC) DEMING STREETBUCKLAND ROAD240 DEMING STREET DEVELOPMENT SITE DRIVEWAY146 HARTFORD ROAD MANCHESTER, CONNECTICUT 06040 860.646.2469 www.fando.com FIGURE 5: TRIP DISTRIBUTION File Path: J:\DWG\P2023\0453\A10\Civil\Plan\20230453A10_TVF01.dwg Layout: FIG 5. TRIP DIST Plotted: Thu, June 22, 2023 - 3:42 PM User: TYLER RUDOLPHJUNE 2023PROJ. NO: 20230453.A10 240 DEMING STREET - SOUTH WINDSOR, CT XX(XX)[XX] = WEEKDAY MORNING PEAK HOUR (WEEKDAY PM PEAK HOUR) [SATURDAY PEAK HOUR] SITE GENERATED TRAFFIC VOLUMES ENTER EXIT TOTAL MORNING AFTERNOON DEMING STREETBUCKLAND ROAD240 DEMING STREET DEVELOPMENT SITE DRIVEWAY146 HARTFORD ROAD MANCHESTER, CONNECTICUT 06040 860.646.2469 www.fando.com FIGURE 6: TRIP GENERATION File Path: J:\DWG\P2023\0453\A10\Civil\Plan\20230453A10_TVF01.dwg Layout: FIG 6. TRIP GEN Plotted: Thu, June 22, 2023 - 3:42 PM User: TYLER RUDOLPHJUNE 2023PROJ. NO: 20230453.A10 240 DEMING STREET - SOUTH WINDSOR, CT XX(XX) = WEEKDAY MORNING PEAK HOUR (WEEKDAY PM PEAK HOUR) [SATURDAY PEAK HOUR] DEMING STREETBUCKLAND ROAD240 DEMING STREET DEVELOPMENT SITE DRIVEWAY146 HARTFORD ROAD MANCHESTER, CONNECTICUT 06040 860.646.2469 www.fando.com FIGURE 7: 2025 COMBINED TRAFFIC VOLUMES File Path: J:\DWG\P2023\0453\A10\Civil\Plan\20230453A10_TVF01.dwg Layout: FIG 7. 2025 COMBINED Plotted: Thu, June 22, 2023 - 3:42 PM User: TYLER RUDOLPHJUNE 2023PROJ. NO: 20230453.A10 240 DEMING STREET - SOUTH WINDSOR, CT \\private\DFS\ProjectData\P2023\0453\A10\Traffic\TIS\TRAFFIC IMPACT STUDY.docx Appendix C Intersection Capacity Analysis Worksheets 2025 Background Traffic Volumes Weekday AM Peak Hour Lanes, Volumes, Timings 240 Deming Street 1: Deming Street & Buckland Road 2025 AM Background Fuss & O'Neill - JJF Synchro 11 Report F:\P2023\0453\A10\Traffic\Synchro\2025 AM Background.syn Page 1 Lane Group EBL EBT EBR WBL WBT WBR NBL NBT NBR SBL SBT SBR Lane Configurations Traffic Volume (vph) 36 63 27 42 40 91 90 417 31 20 557 65 Future Volume (vph) 36 63 27 42 40 91 90 417 31 20 557 65 Ideal Flow (vphpl) 1900 1900 1900 1900 1900 1900 1900 1900 1900 1900 1900 1900 Storage Length (ft) 150 0 130 0 150 0 300 0 Storage Lanes 1 1 1 0 1 0 1 0 Taper Length (ft) 25 25 25 25 Lane Util. Factor 1.00 1.00 1.00 1.00 1.00 1.00 1.00 0.95 0.95 1.00 0.95 0.95 Frt 0.850 0.895 0.990 0.984 Flt Protected 0.950 0.950 0.950 0.950 Satd. Flow (prot) 1770 1863 1583 1770 1667 0 1770 3504 0 1770 3483 0 Flt Permitted 0.666 0.713 0.277 0.475 Satd. Flow (perm) 1241 1863 1583 1328 1667 0 516 3504 0 885 3483 0 Right Turn on Red Yes Yes Yes Yes Satd. Flow (RTOR) 204 99 14 20 Link Speed (mph) 30 30 30 30 Link Distance (ft) 293 623 564 246 Travel Time (s) 6.7 14.2 12.8 5.6 Peak Hour Factor 0.92 0.92 0.92 0.92 0.92 0.92 0.92 0.92 0.92 0.92 0.92 0.92 Adj. Flow (vph) 39 68 29 46 43 99 98 453 34 22 605 71 Shared Lane Traffic (%) Lane Group Flow (vph) 39 68 29 46 142 0 98 487 0 22 676 0 Turn Type Perm NA Perm Perm NA pm+pt NA pm+pt NA Protected Phases 4 4 5 2 1 6 Permitted Phases 4 4 4 2 6 Detector Phase 4 4 4 4 4 5 2 1 6 Switch Phase Minimum Initial (s) 9.0 9.0 9.0 9.0 9.0 15.0 15.0 10.0 15.0 Minimum Split (s) 23.0 23.0 23.0 23.0 23.0 19.0 24.2 14.0 24.2 Total Split (s) 21.0 21.0 21.0 21.0 21.0 17.0 27.0 12.0 22.0 Total Split (%) 35.0% 35.0% 35.0% 35.0% 35.0% 28.3% 45.0% 20.0% 36.7% Maximum Green (s) 16.0 16.0 16.0 16.0 16.0 13.0 20.8 8.0 15.8 Yellow Time (s) 3.0 3.0 3.0 3.0 3.0 3.0 4.2 3.0 4.2 All-Red Time (s) 2.0 2.0 2.0 2.0 2.0 1.0 2.0 1.0 2.0 Lost Time Adjust (s) 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 Total Lost Time (s) 5.0 5.0 5.0 5.0 5.0 4.0 6.2 4.0 6.2 Lead/Lag Lead Lag Lead Lag Lead-Lag Optimize?Yes Yes Yes Yes Vehicle Extension (s) 3.0 3.0 3.0 3.0 3.0 3.0 3.0 3.0 3.0 Recall Mode None None None None None Min Max Min Max Walk Time (s) 7.0 7.0 7.0 7.0 7.0 7.0 7.0 Flash Dont Walk (s) 11.0 11.0 11.0 11.0 11.0 11.0 11.0 Pedestrian Calls (#/hr) 0 0 0 0 0 0 0 Act Effct Green (s) 10.0 10.0 10.0 10.0 10.0 37.8 23.4 28.7 18.3 Actuated g/C Ratio 0.19 0.19 0.19 0.19 0.19 0.71 0.44 0.54 0.34 v/c Ratio 0.17 0.20 0.06 0.19 0.36 0.14 0.32 0.04 0.56 Control Delay 21.4 21.1 0.3 21.6 11.3 4.2 11.4 4.5 17.2 Queue Delay 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 Total Delay 21.4 21.1 0.3 21.6 11.3 4.2 11.4 4.5 17.2 Lanes, Volumes, Timings 240 Deming Street 1: Deming Street & Buckland Road 2025 AM Background Fuss & O'Neill - JJF Synchro 11 Report F:\P2023\0453\A10\Traffic\Synchro\2025 AM Background.syn Page 2 Lane Group EBL EBT EBR WBL WBT WBR NBL NBT NBR SBL SBT SBR LOS C C A C B A B A B Approach Delay 16.8 13.8 10.2 16.8 Approach LOS B B B B Queue Length 50th (ft) 11 20 0 13 12 9 52 2 92 Queue Length 95th (ft) 33 48 0 37 52 25 93 9 154 Internal Link Dist (ft) 213 543 484 166 Turn Bay Length (ft) 150 130 150 300 Base Capacity (vph) 378 568 624 404 577 677 1544 611 1208 Starvation Cap Reductn 0 0 0 0 0 0 0 0 0 Spillback Cap Reductn 0 0 0 0 0 0 0 0 0 Storage Cap Reductn 0 0 0 0 0 0 0 0 0 Reduced v/c Ratio 0.10 0.12 0.05 0.11 0.25 0.14 0.32 0.04 0.56 Intersection Summary Area Type: Other Cycle Length: 60 Actuated Cycle Length: 53.3 Natural Cycle: 70 Control Type: Actuated-Uncoordinated Maximum v/c Ratio: 0.56 Intersection Signal Delay: 14.1 Intersection LOS: B Intersection Capacity Utilization 62.0% ICU Level of Service B Analysis Period (min) 15 Splits and Phases: 1: Deming Street & Buckland Road HCM Signalized Intersection Capacity Analysis 240 Deming Street 1: Deming Street & Buckland Road 2025 AM Background Fuss & O'Neill - JJF Synchro 11 Report F:\P2023\0453\A10\Traffic\Synchro\2025 AM Background.syn Page 3 Movement EBL EBT EBR WBL WBT WBR NBL NBT NBR SBL SBT SBR Lane Configurations Traffic Volume (vph) 36 63 27 42 40 91 90 417 31 20 557 65 Future Volume (vph) 36 63 27 42 40 91 90 417 31 20 557 65 Ideal Flow (vphpl) 1900 1900 1900 1900 1900 1900 1900 1900 1900 1900 1900 1900 Total Lost time (s) 5.0 5.0 5.0 5.0 5.0 4.0 6.2 4.0 6.2 Lane Util. Factor 1.00 1.00 1.00 1.00 1.00 1.00 0.95 1.00 0.95 Frt 1.00 1.00 0.85 1.00 0.90 1.00 0.99 1.00 0.98 Flt Protected 0.95 1.00 1.00 0.95 1.00 0.95 1.00 0.95 1.00 Satd. Flow (prot) 1770 1863 1583 1770 1668 1770 3502 1770 3483 Flt Permitted 0.67 1.00 1.00 0.71 1.00 0.28 1.00 0.47 1.00 Satd. Flow (perm) 1241 1863 1583 1328 1668 515 3502 884 3483 Peak-hour factor, PHF 0.92 0.92 0.92 0.92 0.92 0.92 0.92 0.92 0.92 0.92 0.92 0.92 Adj. Flow (vph) 39 68 29 46 43 99 98 453 34 22 605 71 RTOR Reduction (vph) 0 0 25 0 85 0 0 8 0 0 13 0 Lane Group Flow (vph) 39 68 4 46 57 0 98 479 0 22 663 0 Turn Type Perm NA Perm Perm NA pm+pt NA pm+pt NA Protected Phases 4 4 5 2 1 6 Permitted Phases 4 4 4 2 6 Actuated Green, G (s) 7.6 7.6 7.6 7.6 7.6 35.5 23.4 26.4 18.3 Effective Green, g (s) 7.6 7.6 7.6 7.6 7.6 35.5 23.4 26.4 18.3 Actuated g/C Ratio 0.14 0.14 0.14 0.14 0.14 0.65 0.43 0.49 0.34 Clearance Time (s) 5.0 5.0 5.0 5.0 5.0 4.0 6.2 4.0 6.2 Vehicle Extension (s) 3.0 3.0 3.0 3.0 3.0 3.0 3.0 3.0 3.0 Lane Grp Cap (vph) 173 260 221 185 233 641 1509 561 1173 v/s Ratio Prot c0.04 0.03 c0.04 c0.14 0.01 c0.19 v/s Ratio Perm 0.03 0.00 0.03 0.06 0.01 v/c Ratio 0.23 0.26 0.02 0.25 0.24 0.15 0.32 0.04 0.56 Uniform Delay, d1 20.7 20.8 20.1 20.8 20.8 3.9 10.2 7.3 14.7 Progression Factor 1.00 1.00 1.00 1.00 1.00 1.00 1.00 1.00 1.00 Incremental Delay, d2 0.7 0.5 0.0 0.7 0.5 0.1 0.6 0.0 2.0 Delay (s) 21.4 21.4 20.2 21.5 21.3 4.0 10.7 7.3 16.7 Level of Service C C C C C A B A B Approach Delay (s) 21.1 21.4 9.6 16.4 Approach LOS C C A B Intersection Summary HCM 2000 Control Delay 14.9 HCM 2000 Level of Service B HCM 2000 Volume to Capacity ratio 0.37 Actuated Cycle Length (s) 54.3 Sum of lost time (s) 15.2 Intersection Capacity Utilization 62.0% ICU Level of Service B Analysis Period (min) 15 c Critical Lane Group Lanes, Volumes, Timings 240 Deming Street 2: Deming Street & Site Driveway 2025 AM Background Fuss & O'Neill - JJF Synchro 11 Report F:\P2023\0453\A10\Traffic\Synchro\2025 AM Background.syn Page 4 Lane Group EBL EBT WBT WBR SBL SBR Lane Configurations Traffic Volume (vph) 0 114 173 0 0 0 Future Volume (vph) 0 114 173 0 0 0 Ideal Flow (vphpl) 1900 1900 1900 1900 1900 1900 Lane Util. Factor 1.00 1.00 1.00 1.00 1.00 1.00 Frt Flt Protected Satd. Flow (prot) 0 1863 1863 0 1863 1863 Flt Permitted Satd. Flow (perm) 0 1863 1863 0 1863 1863 Link Speed (mph) 30 30 30 Link Distance (ft) 623 262 110 Travel Time (s) 14.2 6.0 2.5 Peak Hour Factor 0.92 0.92 0.92 0.92 0.92 0.92 Adj. Flow (vph) 0 124 188 0 0 0 Shared Lane Traffic (%) Lane Group Flow (vph) 0 124 188 0 0 0 Sign Control Free Free Stop Intersection Summary Area Type: Other Control Type: Unsignalized Intersection Capacity Utilization 12.4% ICU Level of Service A Analysis Period (min) 15 HCM Unsignalized Intersection Capacity Analysis 240 Deming Street 2: Deming Street & Site Driveway 2025 AM Background Fuss & O'Neill - JJF Synchro 11 Report F:\P2023\0453\A10\Traffic\Synchro\2025 AM Background.syn Page 5 Movement EBL EBT WBT WBR SBL SBR Lane Configurations Traffic Volume (veh/h) 0 114 173 0 0 0 Future Volume (Veh/h) 0 114 173 0 0 0 Sign Control Free Free Stop Grade 0% 0% 0% Peak Hour Factor 0.92 0.92 0.92 0.92 0.92 0.92 Hourly flow rate (vph) 0 124 188 0 0 0 Pedestrians Lane Width (ft) Walking Speed (ft/s) Percent Blockage Right turn flare (veh) Median type None None Median storage veh) Upstream signal (ft) 623 pX, platoon unblocked vC, conflicting volume 188 312 188 vC1, stage 1 conf vol vC2, stage 2 conf vol vCu, unblocked vol 188 312 188 tC, single (s) 4.1 6.4 6.2 tC, 2 stage (s) tF (s) 2.2 3.5 3.3 p0 queue free % 100 100 100 cM capacity (veh/h) 1386 681 854 Direction, Lane # EB 1 WB 1 SB 1 SB 2 Volume Total 124 188 0 0 Volume Left 0 0 0 0 Volume Right 0 0 0 0 cSH 1386 1700 1700 1700 Volume to Capacity 0.00 0.11 0.00 0.00 Queue Length 95th (ft) 0 0 0 0 Control Delay (s) 0.0 0.0 0.0 0.0 Lane LOS A A Approach Delay (s) 0.0 0.0 0.0 Approach LOS A Intersection Summary Average Delay 0.0 Intersection Capacity Utilization 12.4% ICU Level of Service A Analysis Period (min) 15 \\private\DFS\ProjectData\P2023\0453\A10\Traffic\TIS\TRAFFIC IMPACT STUDY.docx Appendix C Intersection Capacity Analysis Worksheets 2025 Combined Traffic Volumes Weekday AM Peak Hour Lanes, Volumes, Timings 240 Deming Street 1: Deming Street & Buckland Road 2025 AM Combined Fuss & O'Neill - JFF Synchro 11 Report F:\P2023\0453\A10\Traffic\Synchro\2025 AM Combined.syn Page 1 Lane Group EBL EBT EBR WBL WBT WBR NBL NBT NBR SBL SBT SBR Lane Configurations Traffic Volume (vph) 36 64 27 49 43 96 90 417 34 22 557 65 Future Volume (vph) 36 64 27 49 43 96 90 417 34 22 557 65 Ideal Flow (vphpl) 1900 1900 1900 1900 1900 1900 1900 1900 1900 1900 1900 1900 Storage Length (ft) 150 0 130 0 150 0 300 0 Storage Lanes 1 1 1 0 1 0 1 0 Taper Length (ft) 25 25 25 25 Lane Util. Factor 1.00 1.00 1.00 1.00 1.00 1.00 1.00 0.95 0.95 1.00 0.95 0.95 Frt 0.850 0.897 0.989 0.984 Flt Protected 0.950 0.950 0.950 0.950 Satd. Flow (prot) 1770 1863 1583 1770 1671 0 1770 3500 0 1770 3483 0 Flt Permitted 0.661 0.711 0.276 0.473 Satd. Flow (perm) 1231 1863 1583 1324 1671 0 514 3500 0 881 3483 0 Right Turn on Red Yes Yes Yes Yes Satd. Flow (RTOR) 204 104 15 20 Link Speed (mph) 30 30 30 30 Link Distance (ft) 243 625 564 263 Travel Time (s) 5.5 14.2 12.8 6.0 Peak Hour Factor 0.92 0.92 0.92 0.92 0.92 0.92 0.92 0.92 0.92 0.92 0.92 0.92 Adj. Flow (vph) 39 70 29 53 47 104 98 453 37 24 605 71 Shared Lane Traffic (%) Lane Group Flow (vph) 39 70 29 53 151 0 98 490 0 24 676 0 Turn Type Perm NA Perm Perm NA pm+pt NA pm+pt NA Protected Phases 4 4 5 2 1 6 Permitted Phases 4 4 4 2 6 Detector Phase 4 4 4 4 4 5 2 1 6 Switch Phase Minimum Initial (s) 9.0 9.0 9.0 9.0 9.0 15.0 15.0 10.0 15.0 Minimum Split (s) 23.0 23.0 23.0 23.0 23.0 19.0 24.2 14.0 24.2 Total Split (s) 21.0 21.0 21.0 21.0 21.0 17.0 27.0 12.0 22.0 Total Split (%) 35.0% 35.0% 35.0% 35.0% 35.0% 28.3% 45.0% 20.0% 36.7% Maximum Green (s) 16.0 16.0 16.0 16.0 16.0 13.0 20.8 8.0 15.8 Yellow Time (s) 3.0 3.0 3.0 3.0 3.0 3.0 4.2 3.0 4.2 All-Red Time (s) 2.0 2.0 2.0 2.0 2.0 1.0 2.0 1.0 2.0 Lost Time Adjust (s) 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 Total Lost Time (s) 5.0 5.0 5.0 5.0 5.0 4.0 6.2 4.0 6.2 Lead/Lag Lead Lag Lead Lag Lead-Lag Optimize?Yes Yes Yes Yes Vehicle Extension (s) 3.0 3.0 3.0 3.0 3.0 3.0 3.0 3.0 3.0 Recall Mode None None None None None Min Max Min Max Walk Time (s) 7.0 7.0 7.0 7.0 7.0 7.0 7.0 Flash Dont Walk (s) 11.0 11.0 11.0 11.0 11.0 11.0 11.0 Pedestrian Calls (#/hr) 0 0 0 0 0 0 0 Act Effct Green (s) 10.1 10.1 10.1 10.1 10.1 37.8 23.4 28.7 18.3 Actuated g/C Ratio 0.19 0.19 0.19 0.19 0.19 0.71 0.44 0.54 0.34 v/c Ratio 0.17 0.20 0.06 0.21 0.38 0.15 0.32 0.04 0.56 Control Delay 21.4 21.1 0.3 22.0 11.4 4.3 11.5 4.6 17.3 Queue Delay 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 Total Delay 21.4 21.1 0.3 22.0 11.4 4.3 11.5 4.6 17.3 Lanes, Volumes, Timings 240 Deming Street 1: Deming Street & Buckland Road 2025 AM Combined Fuss & O'Neill - JFF Synchro 11 Report F:\P2023\0453\A10\Traffic\Synchro\2025 AM Combined.syn Page 2 Lane Group EBL EBT EBR WBL WBT WBR NBL NBT NBR SBL SBT SBR LOS C C A C B A B A B Approach Delay 16.8 14.2 10.3 16.9 Approach LOS B B B B Queue Length 50th (ft) 11 20 0 15 14 9 52 2 92 Queue Length 95th (ft) 33 49 0 41 54 26 94 9 155 Internal Link Dist (ft) 163 545 484 183 Turn Bay Length (ft) 150 130 150 300 Base Capacity (vph) 375 567 623 403 581 675 1541 608 1206 Starvation Cap Reductn 0 0 0 0 0 0 0 0 0 Spillback Cap Reductn 0 0 0 0 0 0 0 0 0 Storage Cap Reductn 0 0 0 0 0 0 0 0 0 Reduced v/c Ratio 0.10 0.12 0.05 0.13 0.26 0.15 0.32 0.04 0.56 Intersection Summary Area Type: Other Cycle Length: 60 Actuated Cycle Length: 53.4 Natural Cycle: 70 Control Type: Actuated-Uncoordinated Maximum v/c Ratio: 0.56 Intersection Signal Delay: 14.2 Intersection LOS: B Intersection Capacity Utilization 62.5% ICU Level of Service B Analysis Period (min) 15 Splits and Phases: 1: Deming Street & Buckland Road HCM Signalized Intersection Capacity Analysis 240 Deming Street 1: Deming Street & Buckland Road 2025 AM Combined Fuss & O'Neill - JFF Synchro 11 Report F:\P2023\0453\A10\Traffic\Synchro\2025 AM Combined.syn Page 3 Movement EBL EBT EBR WBL WBT WBR NBL NBT NBR SBL SBT SBR Lane Configurations Traffic Volume (vph) 36 64 27 49 43 96 90 417 34 22 557 65 Future Volume (vph) 36 64 27 49 43 96 90 417 34 22 557 65 Ideal Flow (vphpl) 1900 1900 1900 1900 1900 1900 1900 1900 1900 1900 1900 1900 Total Lost time (s) 5.0 5.0 5.0 5.0 5.0 4.0 6.2 4.0 6.2 Lane Util. Factor 1.00 1.00 1.00 1.00 1.00 1.00 0.95 1.00 0.95 Frt 1.00 1.00 0.85 1.00 0.90 1.00 0.99 1.00 0.98 Flt Protected 0.95 1.00 1.00 0.95 1.00 0.95 1.00 0.95 1.00 Satd. Flow (prot) 1770 1863 1583 1770 1670 1770 3499 1770 3483 Flt Permitted 0.66 1.00 1.00 0.71 1.00 0.28 1.00 0.47 1.00 Satd. Flow (perm) 1231 1863 1583 1325 1670 514 3499 881 3483 Peak-hour factor, PHF 0.92 0.92 0.92 0.92 0.92 0.92 0.92 0.92 0.92 0.92 0.92 0.92 Adj. Flow (vph) 39 70 29 53 47 104 98 453 37 24 605 71 RTOR Reduction (vph) 0 0 25 0 89 0 0 9 0 0 13 0 Lane Group Flow (vph) 39 70 4 53 62 0 98 481 0 24 663 0 Turn Type Perm NA Perm Perm NA pm+pt NA pm+pt NA Protected Phases 4 4 5 2 1 6 Permitted Phases 4 4 4 2 6 Actuated Green, G (s) 7.7 7.7 7.7 7.7 7.7 35.5 23.4 26.4 18.3 Effective Green, g (s) 7.7 7.7 7.7 7.7 7.7 35.5 23.4 26.4 18.3 Actuated g/C Ratio 0.14 0.14 0.14 0.14 0.14 0.65 0.43 0.49 0.34 Clearance Time (s) 5.0 5.0 5.0 5.0 5.0 4.0 6.2 4.0 6.2 Vehicle Extension (s) 3.0 3.0 3.0 3.0 3.0 3.0 3.0 3.0 3.0 Lane Grp Cap (vph) 174 263 224 187 236 640 1505 559 1171 v/s Ratio Prot 0.04 0.04 c0.04 c0.14 0.01 c0.19 v/s Ratio Perm 0.03 0.00 c0.04 0.06 0.01 v/c Ratio 0.22 0.27 0.02 0.28 0.26 0.15 0.32 0.04 0.57 Uniform Delay, d1 20.7 20.8 20.1 20.9 20.8 4.0 10.2 7.3 14.8 Progression Factor 1.00 1.00 1.00 1.00 1.00 1.00 1.00 1.00 1.00 Incremental Delay, d2 0.7 0.5 0.0 0.8 0.6 0.1 0.6 0.0 2.0 Delay (s) 21.4 21.4 20.1 21.7 21.4 4.1 10.8 7.3 16.8 Level of Service C C C C C A B A B Approach Delay (s) 21.1 21.5 9.7 16.5 Approach LOS C C A B Intersection Summary HCM 2000 Control Delay 15.0 HCM 2000 Level of Service B HCM 2000 Volume to Capacity ratio 0.38 Actuated Cycle Length (s) 54.4 Sum of lost time (s) 15.2 Intersection Capacity Utilization 62.5% ICU Level of Service B Analysis Period (min) 15 c Critical Lane Group Lanes, Volumes, Timings 240 Deming Street 2: Deming Street & Site Driveway 2025 AM Combined Fuss & O'Neill - JFF Synchro 11 Report F:\P2023\0453\A10\Traffic\Synchro\2025 AM Combined.syn Page 4 Lane Group EBL EBT WBT WBR SBL SBR Lane Configurations Traffic Volume (vph) 6 114 173 1 3 15 Future Volume (vph) 6 114 173 1 3 15 Ideal Flow (vphpl) 1900 1900 1900 1900 1900 1900 Lane Util. Factor 1.00 1.00 1.00 1.00 1.00 1.00 Frt 0.999 0.886 Flt Protected 0.997 0.992 Satd. Flow (prot) 0 1857 1861 0 1637 0 Flt Permitted 0.997 0.992 Satd. Flow (perm) 0 1857 1861 0 1637 0 Link Speed (mph) 30 30 30 Link Distance (ft) 625 300 155 Travel Time (s) 14.2 6.8 3.5 Peak Hour Factor 0.92 0.92 0.92 0.92 0.92 0.92 Adj. Flow (vph) 7 124 188 1 3 16 Shared Lane Traffic (%) Lane Group Flow (vph) 0 131 189 0 19 0 Sign Control Free Free Stop Intersection Summary Area Type: Other Control Type: Unsignalized Intersection Capacity Utilization 20.9% ICU Level of Service A Analysis Period (min) 15 HCM Unsignalized Intersection Capacity Analysis 240 Deming Street 2: Deming Street & Site Driveway 2025 AM Combined Fuss & O'Neill - JFF Synchro 11 Report F:\P2023\0453\A10\Traffic\Synchro\2025 AM Combined.syn Page 5 Movement EBL EBT WBT WBR SBL SBR Lane Configurations Traffic Volume (veh/h) 6 114 173 1 3 15 Future Volume (Veh/h) 6 114 173 1 3 15 Sign Control Free Free Stop Grade 0% 0% 0% Peak Hour Factor 0.92 0.92 0.92 0.92 0.92 0.92 Hourly flow rate (vph) 7 124 188 1 3 16 Pedestrians Lane Width (ft) Walking Speed (ft/s) Percent Blockage Right turn flare (veh) Median type None None Median storage veh) Upstream signal (ft) 625 pX, platoon unblocked vC, conflicting volume 189 326 188 vC1, stage 1 conf vol vC2, stage 2 conf vol vCu, unblocked vol 189 326 188 tC, single (s) 4.1 6.4 6.2 tC, 2 stage (s) tF (s) 2.2 3.5 3.3 p0 queue free % 99 100 98 cM capacity (veh/h) 1385 664 853 Direction, Lane # EB 1 WB 1 SB 1 Volume Total 131 189 19 Volume Left 7 0 3 Volume Right 0 1 16 cSH 1385 1700 817 Volume to Capacity 0.01 0.11 0.02 Queue Length 95th (ft) 0 0 2 Control Delay (s) 0.4 0.0 9.5 Lane LOS A A Approach Delay (s) 0.4 0.0 9.5 Approach LOS A Intersection Summary Average Delay 0.7 Intersection Capacity Utilization 20.9% ICU Level of Service A Analysis Period (min) 15 \\private\DFS\ProjectData\P2023\0453\A10\Traffic\TIS\TRAFFIC IMPACT STUDY.docx Appendix D Intersection Capacity Analysis Worksheets 2025 Background Traffic Volumes Weekday PM Peak Hour Lanes, Volumes, Timings 240 Deming Street 1: Deming Street & Buckland Road 2025 PM Background Fuss & O'Neill - JJF Synchro 11 Report F:\P2023\0453\A10\Traffic\Synchro\2025 PM Background.syn Page 1 Lane Group EBL EBT EBR WBL WBT WBR NBL NBT NBR SBL SBT SBR Lane Configurations Traffic Volume (vph) 65 86 40 138 106 170 109 793 77 51 780 103 Future Volume (vph) 65 86 40 138 106 170 109 793 77 51 780 103 Ideal Flow (vphpl) 1900 1900 1900 1900 1900 1900 1900 1900 1900 1900 1900 1900 Storage Length (ft) 150 0 130 0 150 0 300 0 Storage Lanes 1 1 1 0 1 0 1 0 Taper Length (ft) 25 25 25 25 Lane Util. Factor 1.00 1.00 1.00 1.00 1.00 1.00 1.00 0.95 0.95 1.00 0.95 0.95 Frt 0.850 0.907 0.987 0.982 Flt Protected 0.950 0.950 0.950 0.950 Satd. Flow (prot) 1770 1863 1583 1770 1690 0 1770 3493 0 1770 3476 0 Flt Permitted 0.383 0.697 0.181 0.260 Satd. Flow (perm) 713 1863 1583 1298 1690 0 337 3493 0 484 3476 0 Right Turn on Red Yes Yes Yes Yes Satd. Flow (RTOR) 204 132 19 23 Link Speed (mph) 30 30 30 30 Link Distance (ft) 152 625 564 183 Travel Time (s) 3.5 14.2 12.8 4.2 Peak Hour Factor 0.92 0.92 0.92 0.92 0.92 0.92 0.92 0.92 0.92 0.92 0.92 0.92 Adj. Flow (vph) 71 93 43 150 115 185 118 862 84 55 848 112 Shared Lane Traffic (%) Lane Group Flow (vph) 71 93 43 150 300 0 118 946 0 55 960 0 Turn Type Perm NA Perm Perm NA pm+pt NA pm+pt NA Protected Phases 4 4 5 2 1 6 Permitted Phases 4 4 4 2 6 Detector Phase 4 4 4 4 4 5 2 1 6 Switch Phase Minimum Initial (s) 9.0 9.0 9.0 9.0 9.0 15.0 15.0 10.0 15.0 Minimum Split (s) 23.0 23.0 23.0 23.0 23.0 19.0 24.2 14.0 24.2 Total Split (s) 21.0 21.0 21.0 21.0 21.0 17.0 27.0 12.0 22.0 Total Split (%) 35.0% 35.0% 35.0% 35.0% 35.0% 28.3% 45.0% 20.0% 36.7% Maximum Green (s) 16.0 16.0 16.0 16.0 16.0 13.0 20.8 8.0 15.8 Yellow Time (s) 3.0 3.0 3.0 3.0 3.0 3.0 4.2 3.0 4.2 All-Red Time (s) 2.0 2.0 2.0 2.0 2.0 1.0 2.0 1.0 2.0 Lost Time Adjust (s) 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 Total Lost Time (s) 5.0 5.0 5.0 5.0 5.0 4.0 6.2 4.0 6.2 Lead/Lag Lead Lag Lead Lag Lead-Lag Optimize?Yes Yes Yes Yes Vehicle Extension (s) 3.0 3.0 3.0 3.0 3.0 3.0 3.0 3.0 3.0 Recall Mode None None None None None Min Max Min Max Walk Time (s) 7.0 7.0 7.0 7.0 7.0 7.0 7.0 Flash Dont Walk (s) 11.0 11.0 11.0 11.0 11.0 11.0 11.0 Pedestrian Calls (#/hr) 0 0 0 0 0 0 0 Act Effct Green (s) 12.7 12.7 12.7 12.7 12.7 37.3 23.1 28.3 18.1 Actuated g/C Ratio 0.21 0.21 0.21 0.21 0.21 0.63 0.39 0.48 0.31 v/c Ratio 0.46 0.23 0.09 0.54 0.64 0.22 0.69 0.14 0.89 Control Delay 30.5 20.2 0.3 28.0 18.4 6.1 18.4 6.5 32.9 Queue Delay 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 Total Delay 30.5 20.2 0.3 28.0 18.4 6.1 18.4 6.5 32.9 Lanes, Volumes, Timings 240 Deming Street 1: Deming Street & Buckland Road 2025 PM Background Fuss & O'Neill - JJF Synchro 11 Report F:\P2023\0453\A10\Traffic\Synchro\2025 PM Background.syn Page 2 Lane Group EBL EBT EBR WBL WBT WBR NBL NBT NBR SBL SBT SBR LOS C C A C B A B A C Approach Delay 19.6 21.6 17.0 31.4 Approach LOS B C B C Queue Length 50th (ft) 22 27 0 47 52 15 143 7 169 Queue Length 95th (ft) 57 60 0 97 121 35 217 19 #297 Internal Link Dist (ft) 72 545 484 103 Turn Bay Length (ft) 150 130 150 300 Base Capacity (vph) 193 506 578 352 555 529 1375 406 1078 Starvation Cap Reductn 0 0 0 0 0 0 0 0 0 Spillback Cap Reductn 0 0 0 0 0 0 0 0 0 Storage Cap Reductn 0 0 0 0 0 0 0 0 0 Reduced v/c Ratio 0.37 0.18 0.07 0.43 0.54 0.22 0.69 0.14 0.89 Intersection Summary Area Type: Other Cycle Length: 60 Actuated Cycle Length: 59.1 Natural Cycle: 70 Control Type: Actuated-Uncoordinated Maximum v/c Ratio: 0.89 Intersection Signal Delay: 23.3 Intersection LOS: C Intersection Capacity Utilization 77.7% ICU Level of Service D Analysis Period (min) 15 # 95th percentile volume exceeds capacity, queue may be longer. Queue shown is maximum after two cycles. Splits and Phases: 1: Deming Street & Buckland Road HCM Signalized Intersection Capacity Analysis 240 Deming Street 1: Deming Street & Buckland Road 2025 PM Background Fuss & O'Neill - JJF Synchro 11 Report F:\P2023\0453\A10\Traffic\Synchro\2025 PM Background.syn Page 3 Movement EBL EBT EBR WBL WBT WBR NBL NBT NBR SBL SBT SBR Lane Configurations Traffic Volume (vph) 65 86 40 138 106 170 109 793 77 51 780 103 Future Volume (vph) 65 86 40 138 106 170 109 793 77 51 780 103 Ideal Flow (vphpl) 1900 1900 1900 1900 1900 1900 1900 1900 1900 1900 1900 1900 Total Lost time (s) 5.0 5.0 5.0 5.0 5.0 4.0 6.2 4.0 6.2 Lane Util. Factor 1.00 1.00 1.00 1.00 1.00 1.00 0.95 1.00 0.95 Frt 1.00 1.00 0.85 1.00 0.91 1.00 0.99 1.00 0.98 Flt Protected 0.95 1.00 1.00 0.95 1.00 0.95 1.00 0.95 1.00 Satd. Flow (prot) 1770 1863 1583 1770 1690 1770 3492 1770 3477 Flt Permitted 0.38 1.00 1.00 0.70 1.00 0.18 1.00 0.26 1.00 Satd. Flow (perm) 714 1863 1583 1298 1690 337 3492 485 3477 Peak-hour factor, PHF 0.92 0.92 0.92 0.92 0.92 0.92 0.92 0.92 0.92 0.92 0.92 0.92 Adj. Flow (vph) 71 93 43 150 115 185 118 862 84 55 848 112 RTOR Reduction (vph) 0 0 34 0 104 0 0 12 0 0 16 0 Lane Group Flow (vph) 71 93 9 150 196 0 118 934 0 55 944 0 Turn Type Perm NA Perm Perm NA pm+pt NA pm+pt NA Protected Phases 4 4 5 2 1 6 Permitted Phases 4 4 4 2 6 Actuated Green, G (s) 12.7 12.7 12.7 12.7 12.7 35.1 23.1 26.1 18.1 Effective Green, g (s) 12.7 12.7 12.7 12.7 12.7 35.1 23.1 26.1 18.1 Actuated g/C Ratio 0.22 0.22 0.22 0.22 0.22 0.59 0.39 0.44 0.31 Clearance Time (s) 5.0 5.0 5.0 5.0 5.0 4.0 6.2 4.0 6.2 Vehicle Extension (s) 3.0 3.0 3.0 3.0 3.0 3.0 3.0 3.0 3.0 Lane Grp Cap (vph) 153 401 340 279 363 516 1367 388 1066 v/s Ratio Prot 0.05 c0.12 c0.05 c0.27 0.02 c0.27 v/s Ratio Perm 0.10 0.01 0.12 0.09 0.04 v/c Ratio 0.46 0.23 0.03 0.54 0.54 0.23 0.68 0.14 0.89 Uniform Delay, d1 20.2 19.1 18.3 20.5 20.6 7.0 14.9 9.5 19.5 Progression Factor 1.00 1.00 1.00 1.00 1.00 1.00 1.00 1.00 1.00 Incremental Delay, d2 2.2 0.3 0.0 2.0 1.6 0.2 2.8 0.2 10.8 Delay (s) 22.4 19.4 18.3 22.5 22.2 7.3 17.7 9.7 30.3 Level of Service C B B C C A B A C Approach Delay (s) 20.2 22.3 16.5 29.2 Approach LOS C C B C Intersection Summary HCM 2000 Control Delay 22.4 HCM 2000 Level of Service C HCM 2000 Volume to Capacity ratio 0.61 Actuated Cycle Length (s) 59.0 Sum of lost time (s) 15.2 Intersection Capacity Utilization 77.7% ICU Level of Service D Analysis Period (min) 15 c Critical Lane Group Lanes, Volumes, Timings 240 Deming Street 2: Deming Street & Site Driveway 2025 PM Background Fuss & O'Neill - JJF Synchro 11 Report F:\P2023\0453\A10\Traffic\Synchro\2025 PM Background.syn Page 4 Lane Group EBL EBT WBT WBR SBL SBR Lane Configurations Traffic Volume (vph) 0 214 414 0 0 0 Future Volume (vph) 0 214 414 0 0 0 Ideal Flow (vphpl) 1900 1900 1900 1900 1900 1900 Lane Util. Factor 1.00 1.00 1.00 1.00 1.00 1.00 Frt Flt Protected Satd. Flow (prot) 0 1863 1863 0 1863 0 Flt Permitted Satd. Flow (perm) 0 1863 1863 0 1863 0 Link Speed (mph) 30 30 30 Link Distance (ft) 625 300 155 Travel Time (s) 14.2 6.8 3.5 Peak Hour Factor 0.92 0.92 0.92 0.92 0.92 0.92 Adj. Flow (vph) 0 233 450 0 0 0 Shared Lane Traffic (%) Lane Group Flow (vph) 0 233 450 0 0 0 Sign Control Free Free Stop Intersection Summary Area Type: Other Control Type: Unsignalized Intersection Capacity Utilization 25.1% ICU Level of Service A Analysis Period (min) 15 HCM Unsignalized Intersection Capacity Analysis 240 Deming Street 2: Deming Street & Site Driveway 2025 PM Background Fuss & O'Neill - JJF Synchro 11 Report F:\P2023\0453\A10\Traffic\Synchro\2025 PM Background.syn Page 5 Movement EBL EBT WBT WBR SBL SBR Lane Configurations Traffic Volume (veh/h) 0 214 414 0 0 0 Future Volume (Veh/h) 0 214 414 0 0 0 Sign Control Free Free Stop Grade 0% 0% 0% Peak Hour Factor 0.92 0.92 0.92 0.92 0.92 0.92 Hourly flow rate (vph) 0 233 450 0 0 0 Pedestrians Lane Width (ft) Walking Speed (ft/s) Percent Blockage Right turn flare (veh) Median type None None Median storage veh) Upstream signal (ft) 625 pX, platoon unblocked vC, conflicting volume 450 683 450 vC1, stage 1 conf vol vC2, stage 2 conf vol vCu, unblocked vol 450 683 450 tC, single (s) 4.1 6.4 6.2 tC, 2 stage (s) tF (s) 2.2 3.5 3.3 p0 queue free % 100 100 100 cM capacity (veh/h) 1110 415 609 Direction, Lane # EB 1 WB 1 SB 1 Volume Total 233 450 0 Volume Left 0 0 0 Volume Right 0 0 0 cSH 1110 1700 1700 Volume to Capacity 0.00 0.26 0.00 Queue Length 95th (ft) 0 0 0 Control Delay (s) 0.0 0.0 0.0 Lane LOS A Approach Delay (s) 0.0 0.0 0.0 Approach LOS A Intersection Summary Average Delay 0.0 Intersection Capacity Utilization 25.1% ICU Level of Service A Analysis Period (min) 15 \\private\DFS\ProjectData\P2023\0453\A10\Traffic\TIS\TRAFFIC IMPACT STUDY.docx Appendix D Intersection Capacity Analysis Worksheets 2025 Combined Traffic Volumes Weekday PM Peak Hour Lanes, Volumes, Timings 240 Deming Street 1: Deming Street & Buckland Road 2025 PM Combined Fuss & O'Neill - JJF Synchro 11 Report F:\P2023\0453\A10\Traffic\Synchro\2025 PM Combined.syn Page 1 Lane Group EBL EBT EBR WBL WBT WBR NBL NBT NBR SBL SBT SBR Lane Configurations Traffic Volume (vph) 65 89 40 142 108 173 109 793 84 56 780 103 Future Volume (vph) 65 89 40 142 108 173 109 793 84 56 780 103 Ideal Flow (vphpl) 1900 1900 1900 1900 1900 1900 1900 1900 1900 1900 1900 1900 Storage Length (ft) 150 0 130 0 150 0 300 0 Storage Lanes 1 1 1 0 1 0 1 0 Taper Length (ft) 25 25 25 25 Lane Util. Factor 1.00 1.00 1.00 1.00 1.00 1.00 1.00 0.95 0.95 1.00 0.95 0.95 Frt 0.850 0.908 0.986 0.982 Flt Protected 0.950 0.950 0.950 0.950 Satd. Flow (prot) 1770 1863 1583 1770 1691 0 1770 3490 0 1770 3476 0 Flt Permitted 0.375 0.694 0.181 0.255 Satd. Flow (perm) 699 1863 1583 1293 1691 0 337 3490 0 475 3476 0 Right Turn on Red Yes Yes Yes Yes Satd. Flow (RTOR) 204 131 20 23 Link Speed (mph) 30 30 30 30 Link Distance (ft) 152 625 564 183 Travel Time (s) 3.5 14.2 12.8 4.2 Peak Hour Factor 0.92 0.92 0.92 0.92 0.92 0.92 0.92 0.92 0.92 0.92 0.92 0.92 Adj. Flow (vph) 71 97 43 154 117 188 118 862 91 61 848 112 Shared Lane Traffic (%) Lane Group Flow (vph) 71 97 43 154 305 0 118 953 0 61 960 0 Turn Type Perm NA Perm Perm NA pm+pt NA pm+pt NA Protected Phases 4 4 5 2 1 6 Permitted Phases 4 4 4 2 6 Detector Phase 4 4 4 4 4 5 2 1 6 Switch Phase Minimum Initial (s) 9.0 9.0 9.0 9.0 9.0 15.0 15.0 10.0 15.0 Minimum Split (s) 23.0 23.0 23.0 23.0 23.0 19.0 24.2 14.0 24.2 Total Split (s) 21.0 21.0 21.0 21.0 21.0 17.0 27.0 12.0 22.0 Total Split (%) 35.0% 35.0% 35.0% 35.0% 35.0% 28.3% 45.0% 20.0% 36.7% Maximum Green (s) 16.0 16.0 16.0 16.0 16.0 13.0 20.8 8.0 15.8 Yellow Time (s) 3.0 3.0 3.0 3.0 3.0 3.0 4.2 3.0 4.2 All-Red Time (s) 2.0 2.0 2.0 2.0 2.0 1.0 2.0 1.0 2.0 Lost Time Adjust (s) 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 Total Lost Time (s) 5.0 5.0 5.0 5.0 5.0 4.0 6.2 4.0 6.2 Lead/Lag Lead Lag Lead Lag Lead-Lag Optimize?Yes Yes Yes Yes Vehicle Extension (s) 3.0 3.0 3.0 3.0 3.0 3.0 3.0 3.0 3.0 Recall Mode None None None None None Min Max Min Max Walk Time (s) 7.0 7.0 7.0 7.0 7.0 7.0 7.0 Flash Dont Walk (s) 11.0 11.0 11.0 11.0 11.0 11.0 11.0 Pedestrian Calls (#/hr) 0 0 0 0 0 0 0 Act Effct Green (s) 12.8 12.8 12.8 12.8 12.8 37.3 23.0 28.3 18.0 Actuated g/C Ratio 0.22 0.22 0.22 0.22 0.22 0.63 0.39 0.48 0.30 v/c Ratio 0.47 0.24 0.09 0.55 0.65 0.22 0.69 0.15 0.89 Control Delay 31.0 20.3 0.3 28.4 18.8 6.1 18.6 6.7 33.0 Queue Delay 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 Total Delay 31.0 20.3 0.3 28.4 18.8 6.1 18.6 6.7 33.0 Lanes, Volumes, Timings 240 Deming Street 1: Deming Street & Buckland Road 2025 PM Combined Fuss & O'Neill - JJF Synchro 11 Report F:\P2023\0453\A10\Traffic\Synchro\2025 PM Combined.syn Page 2 Lane Group EBL EBT EBR WBL WBT WBR NBL NBT NBR SBL SBT SBR LOS C C A C B A B A C Approach Delay 19.8 22.0 17.2 31.5 Approach LOS B C B C Queue Length 50th (ft) 22 29 0 49 54 15 145 8 170 Queue Length 95th (ft) 57 62 0 99 125 35 219 21 #297 Internal Link Dist (ft) 72 545 484 103 Turn Bay Length (ft) 150 130 150 300 Base Capacity (vph) 189 505 577 350 554 528 1373 402 1076 Starvation Cap Reductn 0 0 0 0 0 0 0 0 0 Spillback Cap Reductn 0 0 0 0 0 0 0 0 0 Storage Cap Reductn 0 0 0 0 0 0 0 0 0 Reduced v/c Ratio 0.38 0.19 0.07 0.44 0.55 0.22 0.69 0.15 0.89 Intersection Summary Area Type: Other Cycle Length: 60 Actuated Cycle Length: 59.1 Natural Cycle: 70 Control Type: Actuated-Uncoordinated Maximum v/c Ratio: 0.89 Intersection Signal Delay: 23.5 Intersection LOS: C Intersection Capacity Utilization 78.0% ICU Level of Service D Analysis Period (min) 15 # 95th percentile volume exceeds capacity, queue may be longer. Queue shown is maximum after two cycles. Splits and Phases: 1: Deming Street & Buckland Road HCM Signalized Intersection Capacity Analysis 240 Deming Street 1: Deming Street & Buckland Road 2025 PM Combined Fuss & O'Neill - JJF Synchro 11 Report F:\P2023\0453\A10\Traffic\Synchro\2025 PM Combined.syn Page 3 Movement EBL EBT EBR WBL WBT WBR NBL NBT NBR SBL SBT SBR Lane Configurations Traffic Volume (vph) 65 89 40 142 108 173 109 793 84 56 780 103 Future Volume (vph) 65 89 40 142 108 173 109 793 84 56 780 103 Ideal Flow (vphpl) 1900 1900 1900 1900 1900 1900 1900 1900 1900 1900 1900 1900 Total Lost time (s) 5.0 5.0 5.0 5.0 5.0 4.0 6.2 4.0 6.2 Lane Util. Factor 1.00 1.00 1.00 1.00 1.00 1.00 0.95 1.00 0.95 Frt 1.00 1.00 0.85 1.00 0.91 1.00 0.99 1.00 0.98 Flt Protected 0.95 1.00 1.00 0.95 1.00 0.95 1.00 0.95 1.00 Satd. Flow (prot) 1770 1863 1583 1770 1691 1770 3489 1770 3477 Flt Permitted 0.37 1.00 1.00 0.69 1.00 0.18 1.00 0.26 1.00 Satd. Flow (perm) 698 1863 1583 1293 1691 337 3489 476 3477 Peak-hour factor, PHF 0.92 0.92 0.92 0.92 0.92 0.92 0.92 0.92 0.92 0.92 0.92 0.92 Adj. Flow (vph) 71 97 43 154 117 188 118 862 91 61 848 112 RTOR Reduction (vph) 0 0 34 0 103 0 0 12 0 0 16 0 Lane Group Flow (vph) 71 97 9 154 202 0 118 941 0 61 944 0 Turn Type Perm NA Perm Perm NA pm+pt NA pm+pt NA Protected Phases 4 4 5 2 1 6 Permitted Phases 4 4 4 2 6 Actuated Green, G (s) 12.8 12.8 12.8 12.8 12.8 35.1 23.1 26.1 18.1 Effective Green, g (s) 12.8 12.8 12.8 12.8 12.8 35.1 23.1 26.1 18.1 Actuated g/C Ratio 0.22 0.22 0.22 0.22 0.22 0.59 0.39 0.44 0.31 Clearance Time (s) 5.0 5.0 5.0 5.0 5.0 4.0 6.2 4.0 6.2 Vehicle Extension (s) 3.0 3.0 3.0 3.0 3.0 3.0 3.0 3.0 3.0 Lane Grp Cap (vph) 151 403 342 280 366 515 1363 385 1064 v/s Ratio Prot 0.05 c0.12 c0.05 c0.27 0.02 c0.27 v/s Ratio Perm 0.10 0.01 0.12 0.09 0.05 v/c Ratio 0.47 0.24 0.03 0.55 0.55 0.23 0.69 0.16 0.89 Uniform Delay, d1 20.2 19.1 18.2 20.6 20.6 7.1 15.0 9.6 19.5 Progression Factor 1.00 1.00 1.00 1.00 1.00 1.00 1.00 1.00 1.00 Incremental Delay, d2 2.3 0.3 0.0 2.3 1.8 0.2 2.9 0.2 11.0 Delay (s) 22.5 19.4 18.3 22.9 22.4 7.3 17.9 9.8 30.5 Level of Service C B B C C A B A C Approach Delay (s) 20.2 22.6 16.7 29.2 Approach LOS C C B C Intersection Summary HCM 2000 Control Delay 22.6 HCM 2000 Level of Service C HCM 2000 Volume to Capacity ratio 0.62 Actuated Cycle Length (s) 59.1 Sum of lost time (s) 15.2 Intersection Capacity Utilization 78.0% ICU Level of Service D Analysis Period (min) 15 c Critical Lane Group Lanes, Volumes, Timings 240 Deming Street 2: Deming Street & Site Driveway 2025 PM Combined Fuss & O'Neill - JJF Synchro 11 Report F:\P2023\0453\A10\Traffic\Synchro\2025 PM Combined.syn Page 4 Lane Group EBL EBT WBT WBR SBL SBR Lane Configurations Traffic Volume (vph) 15 214 414 2 2 9 Future Volume (vph) 15 214 414 2 2 9 Ideal Flow (vphpl) 1900 1900 1900 1900 1900 1900 Lane Util. Factor 1.00 1.00 1.00 1.00 1.00 1.00 Frt 0.999 0.887 Flt Protected 0.997 0.992 Satd. Flow (prot) 0 1857 1861 0 1639 0 Flt Permitted 0.997 0.992 Satd. Flow (perm) 0 1857 1861 0 1639 0 Link Speed (mph) 30 30 30 Link Distance (ft) 625 300 155 Travel Time (s) 14.2 6.8 3.5 Peak Hour Factor 0.92 0.92 0.92 0.92 0.92 0.92 Adj. Flow (vph) 16 233 450 2 2 10 Shared Lane Traffic (%) Lane Group Flow (vph) 0 249 452 0 12 0 Sign Control Free Free Stop Intersection Summary Area Type: Other Control Type: Unsignalized Intersection Capacity Utilization 33.6% ICU Level of Service A Analysis Period (min) 15 HCM Unsignalized Intersection Capacity Analysis 240 Deming Street 2: Deming Street & Site Driveway 2025 PM Combined Fuss & O'Neill - JJF Synchro 11 Report F:\P2023\0453\A10\Traffic\Synchro\2025 PM Combined.syn Page 5 Movement EBL EBT WBT WBR SBL SBR Lane Configurations Traffic Volume (veh/h) 15 214 414 2 2 9 Future Volume (Veh/h) 15 214 414 2 2 9 Sign Control Free Free Stop Grade 0% 0% 0% Peak Hour Factor 0.92 0.92 0.92 0.92 0.92 0.92 Hourly flow rate (vph) 16 233 450 2 2 10 Pedestrians Lane Width (ft) Walking Speed (ft/s) Percent Blockage Right turn flare (veh) Median type None None Median storage veh) Upstream signal (ft) 625 pX, platoon unblocked vC, conflicting volume 452 716 451 vC1, stage 1 conf vol vC2, stage 2 conf vol vCu, unblocked vol 452 716 451 tC, single (s) 4.1 6.4 6.2 tC, 2 stage (s) tF (s) 2.2 3.5 3.3 p0 queue free % 99 99 98 cM capacity (veh/h) 1109 391 608 Direction, Lane # EB 1 WB 1 SB 1 Volume Total 249 452 12 Volume Left 16 0 2 Volume Right 0 2 10 cSH 1109 1700 557 Volume to Capacity 0.01 0.27 0.02 Queue Length 95th (ft) 1 0 2 Control Delay (s) 0.7 0.0 11.6 Lane LOS A B Approach Delay (s) 0.7 0.0 11.6 Approach LOS B Intersection Summary Average Delay 0.4 Intersection Capacity Utilization 33.6% ICU Level of Service A Analysis Period (min) 15 \\private\DFS\ProjectData\P2023\0453\A10\Traffic\TIS\TRAFFIC IMPACT STUDY.docx Appendix E Intersection Capacity Analysis Worksheets 2025 Background Traffic Volumes Saturday Peak Hour Lanes, Volumes, Timings 240 Deming Street 1: Deming Street & Buckland Road 2025 Saturday Background Fuss & O'Neill - JJF Synchro 11 Report F:\P2023\0453\A10\Traffic\Synchro\2025 SAT Background.syn Page 1 Lane Group EBL EBT EBR WBL WBT WBR NBL NBT NBR SBL SBT SBR Lane Configurations Traffic Volume (vph) 89 97 51 107 111 119 88 652 67 52 672 116 Future Volume (vph) 89 97 51 107 111 119 88 652 67 52 672 116 Ideal Flow (vphpl) 1900 1900 1900 1900 1900 1900 1900 1900 1900 1900 1900 1900 Storage Length (ft) 150 0 130 0 150 0 300 0 Storage Lanes 1 1 1 0 1 0 1 0 Taper Length (ft) 25 25 25 25 Lane Util. Factor 1.00 1.00 1.00 1.00 1.00 1.00 1.00 0.95 0.95 1.00 0.95 0.95 Frt 0.850 0.923 0.986 0.978 Flt Protected 0.950 0.950 0.950 0.950 Satd. Flow (prot) 1770 1863 1583 1770 1719 0 1770 3490 0 1770 3461 0 Flt Permitted 0.482 0.689 0.181 0.356 Satd. Flow (perm) 898 1863 1583 1283 1719 0 337 3490 0 663 3461 0 Right Turn on Red Yes Yes Yes Yes Satd. Flow (RTOR) 204 87 20 32 Link Speed (mph) 30 30 30 30 Link Distance (ft) 289 625 564 229 Travel Time (s) 6.6 14.2 12.8 5.2 Peak Hour Factor 0.92 0.92 0.92 0.92 0.92 0.92 0.92 0.92 0.92 0.92 0.92 0.92 Adj. Flow (vph) 97 105 55 116 121 129 96 709 73 57 730 126 Shared Lane Traffic (%) Lane Group Flow (vph) 97 105 55 116 250 0 96 782 0 57 856 0 Turn Type Perm NA Perm Perm NA pm+pt NA pm+pt NA Protected Phases 4 4 5 2 1 6 Permitted Phases 4 4 4 2 6 Detector Phase 4 4 4 4 4 5 2 1 6 Switch Phase Minimum Initial (s) 9.0 9.0 9.0 9.0 9.0 15.0 15.0 10.0 15.0 Minimum Split (s) 23.0 23.0 23.0 23.0 23.0 19.0 24.2 14.0 24.2 Total Split (s) 21.0 21.0 21.0 21.0 21.0 17.0 27.0 12.0 22.0 Total Split (%) 35.0% 35.0% 35.0% 35.0% 35.0% 28.3% 45.0% 20.0% 36.7% Maximum Green (s) 16.0 16.0 16.0 16.0 16.0 13.0 20.8 8.0 15.8 Yellow Time (s) 3.0 3.0 3.0 3.0 3.0 3.0 4.2 3.0 4.2 All-Red Time (s) 2.0 2.0 2.0 2.0 2.0 1.0 2.0 1.0 2.0 Lost Time Adjust (s) 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 Total Lost Time (s) 5.0 5.0 5.0 5.0 5.0 4.0 6.2 4.0 6.2 Lead/Lag Lead Lag Lead Lag Lead-Lag Optimize?Yes Yes Yes Yes Vehicle Extension (s) 3.0 3.0 3.0 3.0 3.0 3.0 3.0 3.0 3.0 Recall Mode None None None None None Min Max Min Max Walk Time (s) 7.0 7.0 7.0 7.0 7.0 7.0 7.0 Flash Dont Walk (s) 11.0 11.0 11.0 11.0 11.0 11.0 11.0 Pedestrian Calls (#/hr) 0 0 0 0 0 0 0 Act Effct Green (s) 12.3 12.3 12.3 12.3 12.3 37.3 23.1 28.3 18.1 Actuated g/C Ratio 0.21 0.21 0.21 0.21 0.21 0.64 0.39 0.48 0.31 v/c Ratio 0.52 0.27 0.11 0.43 0.58 0.18 0.56 0.12 0.79 Control Delay 30.9 20.9 0.5 25.3 19.1 5.7 15.9 6.2 25.2 Queue Delay 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 Total Delay 30.9 20.9 0.5 25.3 19.1 5.7 15.9 6.2 25.2 Lanes, Volumes, Timings 240 Deming Street 1: Deming Street & Buckland Road 2025 Saturday Background Fuss & O'Neill - JJF Synchro 11 Report F:\P2023\0453\A10\Traffic\Synchro\2025 SAT Background.syn Page 2 Lane Group EBL EBT EBR WBL WBT WBR NBL NBT NBR SBL SBT SBR LOS C C A C B A B A C Approach Delay 20.3 21.1 14.8 24.1 Approach LOS C C B C Queue Length 50th (ft) 30 31 0 36 50 11 103 6 135 Queue Length 95th (ft) 71 66 0 77 110 29 170 19 #246 Internal Link Dist (ft) 209 545 484 149 Turn Bay Length (ft) 150 130 150 300 Base Capacity (vph) 245 510 581 351 534 533 1386 471 1088 Starvation Cap Reductn 0 0 0 0 0 0 0 0 0 Spillback Cap Reductn 0 0 0 0 0 0 0 0 0 Storage Cap Reductn 0 0 0 0 0 0 0 0 0 Reduced v/c Ratio 0.40 0.21 0.09 0.33 0.47 0.18 0.56 0.12 0.79 Intersection Summary Area Type: Other Cycle Length: 60 Actuated Cycle Length: 58.6 Natural Cycle: 70 Control Type: Actuated-Uncoordinated Maximum v/c Ratio: 0.79 Intersection Signal Delay: 19.8 Intersection LOS: B Intersection Capacity Utilization 72.2% ICU Level of Service C Analysis Period (min) 15 # 95th percentile volume exceeds capacity, queue may be longer. Queue shown is maximum after two cycles. Splits and Phases: 1: Deming Street & Buckland Road HCM Signalized Intersection Capacity Analysis 240 Deming Street 1: Deming Street & Buckland Road 2025 Saturday Background Fuss & O'Neill - JJF Synchro 11 Report F:\P2023\0453\A10\Traffic\Synchro\2025 SAT Background.syn Page 3 Movement EBL EBT EBR WBL WBT WBR NBL NBT NBR SBL SBT SBR Lane Configurations Traffic Volume (vph) 89 97 51 107 111 119 88 652 67 52 672 116 Future Volume (vph) 89 97 51 107 111 119 88 652 67 52 672 116 Ideal Flow (vphpl) 1900 1900 1900 1900 1900 1900 1900 1900 1900 1900 1900 1900 Total Lost time (s) 5.0 5.0 5.0 5.0 5.0 4.0 6.2 4.0 6.2 Lane Util. Factor 1.00 1.00 1.00 1.00 1.00 1.00 0.95 1.00 0.95 Frt 1.00 1.00 0.85 1.00 0.92 1.00 0.99 1.00 0.98 Flt Protected 0.95 1.00 1.00 0.95 1.00 0.95 1.00 0.95 1.00 Satd. Flow (prot) 1770 1863 1583 1770 1719 1770 3490 1770 3461 Flt Permitted 0.48 1.00 1.00 0.69 1.00 0.18 1.00 0.36 1.00 Satd. Flow (perm) 898 1863 1583 1284 1719 337 3490 662 3461 Peak-hour factor, PHF 0.92 0.92 0.92 0.92 0.92 0.92 0.92 0.92 0.92 0.92 0.92 0.92 Adj. Flow (vph) 97 105 55 116 121 129 96 709 73 57 730 126 RTOR Reduction (vph) 0 0 44 0 69 0 0 12 0 0 22 0 Lane Group Flow (vph) 97 105 11 116 181 0 96 770 0 57 834 0 Turn Type Perm NA Perm Perm NA pm+pt NA pm+pt NA Protected Phases 4 4 5 2 1 6 Permitted Phases 4 4 4 2 6 Actuated Green, G (s) 12.2 12.2 12.2 12.2 12.2 35.1 23.1 26.1 18.1 Effective Green, g (s) 12.2 12.2 12.2 12.2 12.2 35.1 23.1 26.1 18.1 Actuated g/C Ratio 0.21 0.21 0.21 0.21 0.21 0.60 0.39 0.45 0.31 Clearance Time (s) 5.0 5.0 5.0 5.0 5.0 4.0 6.2 4.0 6.2 Vehicle Extension (s) 3.0 3.0 3.0 3.0 3.0 3.0 3.0 3.0 3.0 Lane Grp Cap (vph) 187 388 330 267 358 520 1378 446 1070 v/s Ratio Prot 0.06 0.11 c0.04 c0.22 0.02 c0.24 v/s Ratio Perm c0.11 0.01 0.09 0.07 0.04 v/c Ratio 0.52 0.27 0.03 0.43 0.51 0.18 0.56 0.13 0.78 Uniform Delay, d1 20.5 19.4 18.5 20.1 20.5 6.2 13.7 9.3 18.4 Progression Factor 1.00 1.00 1.00 1.00 1.00 1.00 1.00 1.00 1.00 Incremental Delay, d2 2.4 0.4 0.0 1.1 1.1 0.2 1.6 0.1 5.6 Delay (s) 23.0 19.8 18.5 21.3 21.6 6.4 15.4 9.4 24.0 Level of Service C B B C C A B A C Approach Delay (s) 20.7 21.5 14.4 23.1 Approach LOS C C B C Intersection Summary HCM 2000 Control Delay 19.4 HCM 2000 Level of Service B HCM 2000 Volume to Capacity ratio 0.54 Actuated Cycle Length (s) 58.5 Sum of lost time (s) 15.2 Intersection Capacity Utilization 72.2% ICU Level of Service C Analysis Period (min) 15 c Critical Lane Group Lanes, Volumes, Timings 240 Deming Street 2: Deming Street & Site Driveway 2025 Saturday Background Fuss & O'Neill - JJF Synchro 11 Report F:\P2023\0453\A10\Traffic\Synchro\2025 SAT Background.syn Page 4 Lane Group EBL EBT WBT WBR SBL SBR Lane Configurations Traffic Volume (vph) 0 216 414 0 0 0 Future Volume (vph) 0 216 414 0 0 0 Ideal Flow (vphpl) 1900 1900 1900 1900 1900 1900 Lane Util. Factor 1.00 1.00 1.00 1.00 1.00 1.00 Frt Flt Protected Satd. Flow (prot) 0 1863 1863 0 1863 0 Flt Permitted Satd. Flow (perm) 0 1863 1863 0 1863 0 Link Speed (mph) 30 30 30 Link Distance (ft) 625 300 155 Travel Time (s) 14.2 6.8 3.5 Peak Hour Factor 0.92 0.92 0.92 0.92 0.92 0.92 Adj. Flow (vph) 0 235 450 0 0 0 Shared Lane Traffic (%) Lane Group Flow (vph) 0 235 450 0 0 0 Sign Control Free Free Stop Intersection Summary Area Type: Other Control Type: Unsignalized Intersection Capacity Utilization 25.1% ICU Level of Service A Analysis Period (min) 15 HCM Unsignalized Intersection Capacity Analysis 240 Deming Street 2: Deming Street & Site Driveway 2025 Saturday Background Fuss & O'Neill - JJF Synchro 11 Report F:\P2023\0453\A10\Traffic\Synchro\2025 SAT Background.syn Page 5 Movement EBL EBT WBT WBR SBL SBR Lane Configurations Traffic Volume (veh/h) 0 216 414 0 0 0 Future Volume (Veh/h) 0 216 414 0 0 0 Sign Control Free Free Stop Grade 0% 0% 0% Peak Hour Factor 0.92 0.92 0.92 0.92 0.92 0.92 Hourly flow rate (vph) 0 235 450 0 0 0 Pedestrians Lane Width (ft) Walking Speed (ft/s) Percent Blockage Right turn flare (veh) Median type None None Median storage veh) Upstream signal (ft) 625 pX, platoon unblocked vC, conflicting volume 450 685 450 vC1, stage 1 conf vol vC2, stage 2 conf vol vCu, unblocked vol 450 685 450 tC, single (s) 4.1 6.4 6.2 tC, 2 stage (s) tF (s) 2.2 3.5 3.3 p0 queue free % 100 100 100 cM capacity (veh/h) 1110 414 609 Direction, Lane # EB 1 WB 1 SB 1 Volume Total 235 450 0 Volume Left 0 0 0 Volume Right 0 0 0 cSH 1110 1700 1700 Volume to Capacity 0.00 0.26 0.00 Queue Length 95th (ft) 0 0 0 Control Delay (s) 0.0 0.0 0.0 Lane LOS A Approach Delay (s) 0.0 0.0 0.0 Approach LOS A Intersection Summary Average Delay 0.0 Intersection Capacity Utilization 25.1% ICU Level of Service A Analysis Period (min) 15 \\private\DFS\ProjectData\P2023\0453\A10\Traffic\TIS\TRAFFIC IMPACT STUDY.docx Appendix E Intersection Capacity Analysis Worksheets 2025 Combined Traffic Volumes Saturday Peak Hour Lanes, Volumes, Timings 240 Deming Street 1: Deming Street & Buckland Road 2025 Saturday Combined Fuss & O'Neill - JJF Synchro 11 Report F:\P2023\0453\A10\Traffic\Synchro\2025 SAT Combined.syn Page 1 Lane Group EBL EBT EBR WBL WBT WBR NBL NBT NBR SBL SBT SBR Lane Configurations Traffic Volume (vph) 89 99 51 113 113 123 88 652 73 56 672 116 Future Volume (vph) 89 99 51 113 113 123 88 652 73 56 672 116 Ideal Flow (vphpl) 1900 1900 1900 1900 1900 1900 1900 1900 1900 1900 1900 1900 Storage Length (ft) 150 0 130 0 150 0 300 0 Storage Lanes 1 1 1 0 1 0 1 0 Taper Length (ft) 25 25 25 25 Lane Util. Factor 1.00 1.00 1.00 1.00 1.00 1.00 1.00 0.95 0.95 1.00 0.95 0.95 Frt 0.850 0.922 0.985 0.978 Flt Protected 0.950 0.950 0.950 0.950 Satd. Flow (prot) 1770 1863 1583 1770 1717 0 1770 3486 0 1770 3461 0 Flt Permitted 0.470 0.687 0.181 0.354 Satd. Flow (perm) 875 1863 1583 1280 1717 0 337 3486 0 659 3461 0 Right Turn on Red Yes Yes Yes Yes Satd. Flow (RTOR) 204 89 22 32 Link Speed (mph) 30 30 30 30 Link Distance (ft) 273 625 564 270 Travel Time (s) 6.2 14.2 12.8 6.1 Peak Hour Factor 0.92 0.92 0.92 0.92 0.92 0.92 0.92 0.92 0.92 0.92 0.92 0.92 Adj. Flow (vph) 97 108 55 123 123 134 96 709 79 61 730 126 Shared Lane Traffic (%) Lane Group Flow (vph) 97 108 55 123 257 0 96 788 0 61 856 0 Turn Type Perm NA Perm Perm NA pm+pt NA pm+pt NA Protected Phases 4 4 5 2 1 6 Permitted Phases 4 4 4 2 6 Detector Phase 4 4 4 4 4 5 2 1 6 Switch Phase Minimum Initial (s) 9.0 9.0 9.0 9.0 9.0 15.0 15.0 10.0 15.0 Minimum Split (s) 23.0 23.0 23.0 23.0 23.0 19.0 24.2 14.0 24.2 Total Split (s) 21.0 21.0 21.0 21.0 21.0 17.0 27.0 12.0 22.0 Total Split (%) 35.0% 35.0% 35.0% 35.0% 35.0% 28.3% 45.0% 20.0% 36.7% Maximum Green (s) 16.0 16.0 16.0 16.0 16.0 13.0 20.8 8.0 15.8 Yellow Time (s) 3.0 3.0 3.0 3.0 3.0 3.0 4.2 3.0 4.2 All-Red Time (s) 2.0 2.0 2.0 2.0 2.0 1.0 2.0 1.0 2.0 Lost Time Adjust (s) 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 Total Lost Time (s) 5.0 5.0 5.0 5.0 5.0 4.0 6.2 4.0 6.2 Lead/Lag Lead Lag Lead Lag Lead-Lag Optimize?Yes Yes Yes Yes Vehicle Extension (s) 3.0 3.0 3.0 3.0 3.0 3.0 3.0 3.0 3.0 Recall Mode None None None None None Min Max Min Max Walk Time (s) 7.0 7.0 7.0 7.0 7.0 7.0 7.0 Flash Dont Walk (s) 11.0 11.0 11.0 11.0 11.0 11.0 11.0 Pedestrian Calls (#/hr) 0 0 0 0 0 0 0 Act Effct Green (s) 12.5 12.5 12.5 12.5 12.5 37.3 23.1 28.3 18.0 Actuated g/C Ratio 0.21 0.21 0.21 0.21 0.21 0.63 0.39 0.48 0.31 v/c Ratio 0.52 0.27 0.11 0.45 0.59 0.18 0.57 0.13 0.79 Control Delay 31.2 20.9 0.5 25.7 19.2 5.8 16.1 6.3 25.5 Queue Delay 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 Total Delay 31.2 20.9 0.5 25.7 19.2 5.8 16.1 6.3 25.5 Lanes, Volumes, Timings 240 Deming Street 1: Deming Street & Buckland Road 2025 Saturday Combined Fuss & O'Neill - JJF Synchro 11 Report F:\P2023\0453\A10\Traffic\Synchro\2025 SAT Combined.syn Page 2 Lane Group EBL EBT EBR WBL WBT WBR NBL NBT NBR SBL SBT SBR LOS C C A C B A B A C Approach Delay 20.4 21.3 15.0 24.2 Approach LOS C C B C Queue Length 50th (ft) 31 32 0 38 52 11 109 7 140 Queue Length 95th (ft) 72 67 0 81 114 29 171 21 #246 Internal Link Dist (ft) 193 545 484 190 Turn Bay Length (ft) 150 130 150 300 Base Capacity (vph) 238 508 580 349 532 531 1380 468 1084 Starvation Cap Reductn 0 0 0 0 0 0 0 0 0 Spillback Cap Reductn 0 0 0 0 0 0 0 0 0 Storage Cap Reductn 0 0 0 0 0 0 0 0 0 Reduced v/c Ratio 0.41 0.21 0.09 0.35 0.48 0.18 0.57 0.13 0.79 Intersection Summary Area Type: Other Cycle Length: 60 Actuated Cycle Length: 58.8 Natural Cycle: 70 Control Type: Actuated-Uncoordinated Maximum v/c Ratio: 0.79 Intersection Signal Delay: 20.0 Intersection LOS: C Intersection Capacity Utilization 72.6% ICU Level of Service C Analysis Period (min) 15 # 95th percentile volume exceeds capacity, queue may be longer. Queue shown is maximum after two cycles. Splits and Phases: 1: Deming Street & Buckland Road HCM Signalized Intersection Capacity Analysis 240 Deming Street 1: Deming Street & Buckland Road 2025 Saturday Combined Fuss & O'Neill - JJF Synchro 11 Report F:\P2023\0453\A10\Traffic\Synchro\2025 SAT Combined.syn Page 3 Movement EBL EBT EBR WBL WBT WBR NBL NBT NBR SBL SBT SBR Lane Configurations Traffic Volume (vph) 89 99 51 113 113 123 88 652 73 56 672 116 Future Volume (vph) 89 99 51 113 113 123 88 652 73 56 672 116 Ideal Flow (vphpl) 1900 1900 1900 1900 1900 1900 1900 1900 1900 1900 1900 1900 Total Lost time (s) 5.0 5.0 5.0 5.0 5.0 4.0 6.2 4.0 6.2 Lane Util. Factor 1.00 1.00 1.00 1.00 1.00 1.00 0.95 1.00 0.95 Frt 1.00 1.00 0.85 1.00 0.92 1.00 0.98 1.00 0.98 Flt Protected 0.95 1.00 1.00 0.95 1.00 0.95 1.00 0.95 1.00 Satd. Flow (prot) 1770 1863 1583 1770 1717 1770 3486 1770 3461 Flt Permitted 0.47 1.00 1.00 0.69 1.00 0.18 1.00 0.35 1.00 Satd. Flow (perm) 875 1863 1583 1280 1717 337 3486 659 3461 Peak-hour factor, PHF 0.92 0.92 0.92 0.92 0.92 0.92 0.92 0.92 0.92 0.92 0.92 0.92 Adj. Flow (vph) 97 108 55 123 123 134 96 709 79 61 730 126 RTOR Reduction (vph) 0 0 43 0 70 0 0 13 0 0 22 0 Lane Group Flow (vph) 97 108 12 123 187 0 96 775 0 61 834 0 Turn Type Perm NA Perm Perm NA pm+pt NA pm+pt NA Protected Phases 4 4 5 2 1 6 Permitted Phases 4 4 4 2 6 Actuated Green, G (s) 12.5 12.5 12.5 12.5 12.5 35.1 23.1 26.1 18.1 Effective Green, g (s) 12.5 12.5 12.5 12.5 12.5 35.1 23.1 26.1 18.1 Actuated g/C Ratio 0.21 0.21 0.21 0.21 0.21 0.60 0.39 0.44 0.31 Clearance Time (s) 5.0 5.0 5.0 5.0 5.0 4.0 6.2 4.0 6.2 Vehicle Extension (s) 3.0 3.0 3.0 3.0 3.0 3.0 3.0 3.0 3.0 Lane Grp Cap (vph) 186 396 336 272 365 517 1369 443 1065 v/s Ratio Prot 0.06 0.11 c0.04 c0.22 0.02 c0.24 v/s Ratio Perm c0.11 0.01 0.10 0.07 0.04 v/c Ratio 0.52 0.27 0.03 0.45 0.51 0.19 0.57 0.14 0.78 Uniform Delay, d1 20.5 19.4 18.4 20.2 20.5 6.3 13.9 9.4 18.6 Progression Factor 1.00 1.00 1.00 1.00 1.00 1.00 1.00 1.00 1.00 Incremental Delay, d2 2.6 0.4 0.0 1.2 1.2 0.2 1.7 0.1 5.8 Delay (s) 23.1 19.7 18.4 21.4 21.7 6.5 15.6 9.6 24.3 Level of Service C B B C C A B A C Approach Delay (s) 20.7 21.6 14.6 23.3 Approach LOS C C B C Intersection Summary HCM 2000 Control Delay 19.6 HCM 2000 Level of Service B HCM 2000 Volume to Capacity ratio 0.55 Actuated Cycle Length (s) 58.8 Sum of lost time (s) 15.2 Intersection Capacity Utilization 72.6% ICU Level of Service C Analysis Period (min) 15 c Critical Lane Group Lanes, Volumes, Timings 240 Deming Street 2: Deming Street & Site Driveway 2025 Saturday Combined Fuss & O'Neill - JJF Synchro 11 Report F:\P2023\0453\A10\Traffic\Synchro\2025 SAT Combined.syn Page 4 Lane Group EBL EBT WBT WBR SBL SBR Lane Configurations Traffic Volume (vph) 12 216 337 2 12 2 Future Volume (vph) 12 216 337 2 12 2 Ideal Flow (vphpl) 1900 1900 1900 1900 1900 1900 Lane Util. Factor 1.00 1.00 1.00 1.00 1.00 1.00 Frt 0.999 0.982 Flt Protected 0.997 0.958 Satd. Flow (prot) 0 1857 1861 0 1752 0 Flt Permitted 0.997 0.958 Satd. Flow (perm) 0 1857 1861 0 1752 0 Link Speed (mph) 30 30 30 Link Distance (ft) 625 300 155 Travel Time (s) 14.2 6.8 3.5 Peak Hour Factor 0.92 0.92 0.92 0.92 0.92 0.92 Adj. Flow (vph) 13 235 366 2 13 2 Shared Lane Traffic (%) Lane Group Flow (vph) 0 248 368 0 15 0 Sign Control Free Free Stop Intersection Summary Area Type: Other Control Type: Unsignalized Intersection Capacity Utilization 31.2% ICU Level of Service A Analysis Period (min) 15 HCM Unsignalized Intersection Capacity Analysis 240 Deming Street 2: Deming Street & Site Driveway 2025 Saturday Combined Fuss & O'Neill - JJF Synchro 11 Report F:\P2023\0453\A10\Traffic\Synchro\2025 SAT Combined.syn Page 5 Movement EBL EBT WBT WBR SBL SBR Lane Configurations Traffic Volume (veh/h) 12 216 337 2 12 2 Future Volume (Veh/h) 12 216 337 2 12 2 Sign Control Free Free Stop Grade 0% 0% 0% Peak Hour Factor 0.92 0.92 0.92 0.92 0.92 0.92 Hourly flow rate (vph) 13 235 366 2 13 2 Pedestrians Lane Width (ft) Walking Speed (ft/s) Percent Blockage Right turn flare (veh) Median type None None Median storage veh) Upstream signal (ft) 625 pX, platoon unblocked vC, conflicting volume 368 628 367 vC1, stage 1 conf vol vC2, stage 2 conf vol vCu, unblocked vol 368 628 367 tC, single (s) 4.1 6.4 6.2 tC, 2 stage (s) tF (s) 2.2 3.5 3.3 p0 queue free % 99 97 100 cM capacity (veh/h) 1191 442 678 Direction, Lane # EB 1 WB 1 SB 1 Volume Total 248 368 15 Volume Left 13 0 13 Volume Right 0 2 2 cSH 1191 1700 463 Volume to Capacity 0.01 0.22 0.03 Queue Length 95th (ft) 1 0 3 Control Delay (s) 0.5 0.0 13.0 Lane LOS A B Approach Delay (s) 0.5 0.0 13.0 Approach LOS B Intersection Summary Average Delay 0.5 Intersection Capacity Utilization 31.2% ICU Level of Service A Analysis Period (min) 15 \\private\DFS\ProjectData\P2023\0453\A10\Traffic\TIS\TRAFFIC IMPACT STUDY.docx Appendix F Turning Movement Count (TMC) Data NE Traffic Counts (413) 579-8366 emayboroda@netrafficcounts.com www.netrafficcounts.com CLIENT Fuss & O'Neill STREET 1 Buckland Road CITY/TOWN South Windsor, CT STREET 2 Deming Street WEATHER Sunny DATE 06/02/2023, 06/03/2023 INTERSECTION #1 Passenger Cars & Heavy Vehicles Combined Buckland Rd - Northbound Buckland Rd - Southbound Deming St - Eastbound Deming St - Westbound Start Time U-Turn Left Thru Right U-Turn Left Thru Right U-Turn Left Thru Right U-Turn Left Thru Right 7:00 AM 0 10 82 3 0 6 110 13 0 6 6 14 0 9 6 17 7:15 AM 0 12 89 1 0 11 122 6 0 0 6 8 0 3 12 12 7:30 AM 0 15 105 7 0 5 160 23 0 4 9 14 0 7 15 6 7:45 AM 0 34 121 5 0 2 139 22 0 5 8 12 0 4 19 10 8:00 AM 0 28 94 6 0 3 124 17 0 7 8 19 0 13 16 5 8:15 AM 0 26 82 3 0 6 139 16 0 7 5 19 0 7 18 7 8:30 AM 0 12 109 9 0 3 160 11 0 10 11 17 0 0 19 5 8:45 AM 0 22 124 12 0 8 123 20 0 17 15 31 0 15 9 9 PM 4:00 PM 0 24 197 28 0 14 206 28 0 34 22 47 0 14 22 12 4:15 PM 0 31 201 15 0 16 176 25 0 33 24 43 0 11 21 13 4:30 PM 0 24 177 16 0 10 205 26 0 29 27 36 0 13 17 7 4:45 PM 0 28 192 16 0 10 165 22 0 39 31 41 0 26 24 7 5:00 PM 0 30 170 23 0 8 180 17 0 39 37 36 0 20 17 15 5:15 PM 0 13 173 18 0 6 200 21 0 30 40 37 0 16 22 12 5:30 PM 0 31 219 27 0 8 142 29 0 23 27 33 0 13 21 9 5:45 PM 0 31 186 20 0 10 156 20 0 28 19 20 0 10 36 13 SAT 11:00 AM 0 21 113 14 0 7 110 26 0 26 30 20 0 13 29 10 11:15 AM 0 23 143 13 0 10 154 23 0 41 26 35 0 14 25 12 11:30 AM 0 21 155 20 0 19 146 22 0 30 21 33 0 15 21 7 11:45 AM 0 21 176 17 0 15 137 29 0 23 22 25 0 24 26 12 12:00 PM 0 16 132 24 0 14 188 35 0 24 28 37 0 16 20 13 12:15 PM 0 22 138 14 0 11 177 28 0 26 28 26 0 27 28 12 12:30 PM 0 27 177 11 0 11 142 22 0 32 31 29 0 20 21 13 12:45 PM 0 28 159 16 0 8 129 21 0 34 30 23 0 31 21 12 1:00 PM 0 32 175 17 0 17 158 22 0 22 19 24 0 16 20 8 1:15 PM 1 25 154 27 0 14 167 23 0 29 23 21 0 10 13 13 1:30 PM 0 25 163 21 0 17 126 27 0 21 15 21 0 17 21 7 1:45 PM 0 28 167 17 0 13 144 25 0 36 30 27 0 18 25 14 Buckland Rd - Northbound Buckland Rd - Southbound Deming St - Eastbound Deming St - Westbound AM PEAK HOURS 8:00 AM U-Turn Left Thru Right U-Turn Left Thru Right U-Turn Left Thru Right U-Turn Left Thru Right 0 88 409 30 0 20 546 64 0 41 39 86 0 35 62 26 PHF 0.83 0.91 0.66 0.90 HV%0.0%0.0%1.5%0.0%0.0%0.0%0.9%0.0%0.0%0.0%0.0%0.0%0.0%0.0%0.0%0.0% Buckland Rd - Northbound Buckland Rd - Southbound Deming St - Eastbound Deming St - Westbound PM PEAK HOURS 4:00 PM U-Turn Left Thru Right U-Turn Left Thru Right U-Turn Left Thru Right U-Turn Left Thru Right 0 107 767 75 0 50 752 101 0 135 104 167 0 64 84 39 PHF 0.95 0.91 0.91 0.82 HV%0.0%0.0%0.7%0.0%0.0%0.0%0.0%0.0%0.0%0.0%0.0%0.0%0.0%0.0%0.0%0.0% Buckland Rd - Northbound Buckland Rd - Southbound Deming St - Eastbound Deming St - Westbound SAT PEAK HOURS 11:45 AM U-Turn Left Thru Right U-Turn Left Thru Right U-Turn Left Thru Right U-Turn Left Thru Right 0 86 623 66 0 51 644 114 0 105 109 117 0 87 95 50 PHF 0.90 0.85 0.90 0.87 HV%0.0%0.0%0.8%0.0%0.0%0.0%0.9%0.0%0.0%0.0%0.0%0.9%0.0%0.0%0.0%0.0% NE Traffic Counts (413) 579-8366 emayboroda@netrafficcounts.com www.netrafficcounts.com CLIENT Fuss & O'Neill STREET 1 Buckland Road CITY/TOWN South Windsor, CT STREET 2 Deming Street WEATHER Sunny DATE 06/02/2023, 06/03/2023 INTERSECTION #1 Heavy Vehicles Buckland Rd - Northbound Buckland Rd - Southbound Deming St - Eastbound Deming St - Westbound Start Time U-Turn Left Thru Right U-Turn Left Thru Right U-Turn Left Thru Right U-Turn Left Thru Right 7:00 AM 0 0 0 0 0 0 4 0 0 0 0 1 0 0 0 0 7:15 AM 0 0 3 0 0 0 1 0 0 0 0 0 0 0 0 0 7:30 AM 0 0 1 0 0 0 1 0 0 0 0 0 0 0 0 0 7:45 AM 0 0 1 0 0 0 2 0 0 0 0 0 0 0 0 0 8:00 AM 0 0 1 0 0 0 1 0 0 0 0 0 0 0 0 0 8:15 AM 0 0 2 0 0 0 3 0 0 0 0 0 0 0 0 0 8:30 AM 0 0 2 0 0 0 0 0 0 0 0 0 0 0 0 0 8:45 AM 0 0 1 0 0 0 1 0 0 0 0 0 0 0 0 0 4:00 PM 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 4:15 PM 0 0 3 0 0 0 0 0 0 0 0 0 0 0 0 0 4:30 PM 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 4:45 PM 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 5:00 PM 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 5:15 PM 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 5:30 PM 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 5:45 PM 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 11:00 AM 0 1 3 0 0 0 1 0 0 1 0 0 0 0 0 0 11:15 AM 0 0 2 0 0 0 1 0 0 0 0 0 0 0 0 0 11:30 AM 0 0 3 0 0 0 0 0 0 0 0 0 0 0 0 0 11:45 AM 0 0 2 0 0 0 2 0 0 0 0 1 0 0 0 0 12:00 PM 0 0 0 0 0 0 4 0 0 0 0 0 0 0 0 0 12:15 PM 0 0 2 0 0 0 0 0 0 0 0 0 0 0 0 0 12:30 PM 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 12:45 PM 0 0 1 0 0 0 2 0 0 0 0 0 0 0 0 0 1:00 PM 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1:15 PM 0 1 1 0 0 0 1 0 0 0 0 0 0 0 0 0 1:30 PM 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 1:45 PM 0 0 2 0 0 0 0 0 0 0 0 0 0 0 0 0 Buckland Rd - Northbound Buckland Rd - Southbound Deming St - Eastbound Deming St - Westbound AM PEAK HOURS 8:00 AM U-Turn Left Thru Right U-Turn Left Thru Right U-Turn Left Thru Right U-Turn Left Thru Right 0 0 6 0 0 0 5 0 0 0 0 0 0 0 0 0 Buckland Rd - Northbound Buckland Rd - Southbound Deming St - Eastbound Deming St - Westbound PM PEAK HOURS 4:00 PM U-Turn Left Thru Right U-Turn Left Thru Right U-Turn Left Thru Right U-Turn Left Thru Right 0 0 5 0 0 0 0 0 0 0 0 0 0 0 0 0 Buckland Rd - Northbound Buckland Rd - Southbound Deming St - Eastbound Deming St - Westbound PM PEAK HOURS 11:45 AM U-Turn Left Thru Right U-Turn Left Thru Right U-Turn Left Thru Right U-Turn Left Thru Right 0 0 5 0 0 0 6 0 0 0 0 1 0 0 0 0 NE Traffic Counts (413) 579-8366 emayboroda@netrafficcounts.com www.netrafficcounts.com CLIENT Fuss & O'Neill STREET 1 Buckland Road CITY/TOWN South Windsor, CT STREET 2 Deming Street WEATHER Sunny DATE 06/02/2023, 06/03/2023 INTERSECTION #1 Pedestrians and Bicycles Buckland Rd - Northbound Buckland Rd - Southbound Deming St - Eastbound Deming St - Westbound Start Time Peds Left Thru Right Peds Left Thru Right Peds Left Thru Right Peds Left Thru Right 7:00 AM 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 7:15 AM 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 7:30 AM 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 7:45 AM 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 8:00 AM 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 8:15 AM 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 8:30 AM 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 8:45 AM 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 4:00 PM 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 4:15 PM 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 4:30 PM 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 4:45 PM 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 5:00 PM 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 5:15 PM 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 5:30 PM 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 5:45 PM 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 11:00 AM 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 11:15 AM 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 11:30 AM 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 11:45 AM 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 12:00 PM 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 12:15 PM 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 12:30 PM 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 12:45 PM 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1:00 PM 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1:15 PM 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1:30 PM 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1:45 PM 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 Buckland Rd - Northbound Buckland Rd - Southbound Deming St - Eastbound Deming St - Westbound AM PEAK HOURS 8:00 AM Peds Left Thru Right Peds Left Thru Right Peds Left Thru Right Peds Left Thru Right 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 Buckland Rd - Northbound Buckland Rd - Southbound Deming St - Eastbound Deming St - Westbound PM PEAK HOURS 4:00 PM Peds Left Thru Right Peds Left Thru Right Peds Left Thru Right Peds Left Thru Right 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 Buckland Rd - Northbound Buckland Rd - Southbound Deming St - Eastbound Deming St - Westbound PM PEAK HOURS 11:45 AM Peds Left Thru Right Peds Left Thru Right Peds Left Thru Right Peds Left Thru Right 0 0 0 0 0 0 1 0 0 0 1 0 0 0 0 0 \\private\DFS\ProjectData\P2023\0453\A10\Traffic\TIS\TRAFFIC IMPACT STUDY.docx Appendix G Crash Data Records Date Of Time Of No. ofIntersectingRoad SurfaceContributingCrashCrashSeverityVeh.TownMilemarkerRoadway RoadwayCollision TypeWeatherLight Condition Condition Circumstances5/26/202010:13:00PDO2South Windsor0.41Buckland RoadDeming StreetAngleCloudyDaylightDryNone6/13/202017:27:00Suspected Inj.2South Windsor0.41Buckland RoadDeming StreetFront to frontClearDaylightDryNone10/14/20207:43:00PDO1South Windsor0.41Buckland RoadDeming StreetNot ApplicableClearDaylightDryGlare12/22/202011:42:00PDO2South Windsor0.41Buckland RoadDeming StreetFront to rearClearDaylightDryNone2/26/202117:53:00Suspected Inj.2South Windsor0.41Buckland RoadDeming StreetAngleClearDark-LightedDryNone5/13/20219:59:00Suspected Inj.2South Windsor0.41Buckland RoadDeming StreetAngleClearDaylightDryNone6/10/20219:55:00PDO2South Windsor0.41Buckland RoadDeming StreetFront to rearClearDaylightDryNone7/6/202114:20:00Possible Inj.2South Windsor0.41Buckland RoadDeming StreetAngleClearDaylightDryNone7/30/202111:43:00PDO2South Windsor0.41Buckland RoadDeming StreetFront to rearClearDaylightDryNone7/13/202114:04:00Possible Inj.2South Windsor0.41Buckland RoadDeming StreetFront to rearClearDaylightDryNone10/13/202114:57:00PDO2South Windsor0.43Buckland RoadUnknownSideswipe, same directionCloudyDaylightDryNone12/2/202115:32:00PDO2South Windsor0.41Buckland RoadDeming StreetAngleRainDaylightWetNone1/4/202210:33:00PDO2South Windsor0.38Buckland RoadUnknownFront to rearClearDaylightDryNone4/14/202216:34:00Suspected Inj.2South Windsor0.44Deming StreetBuckland RoadAngleClearDaylightDryNone5/31/202216:29:00PDO2South Windsor0.39Buckland RoadUnknownFront to rearClearDaylightDryNone7/2/202217:13:00PDO2South Windsor0.41Buckland RoadDeming StreetFront to rearClearDaylightDryNone10/19/202219:00:00Suspected Inj.2South Windsor0.41Buckland RoadUnknownAngleClearDark-LightedDryNone10/30/202214:26:00Possible Inj.2South Windsor0.44Deming StreetBuckland RoadFront to rearClearDaylightDryNone10/27/202219:07:00Possible Inj.2South Windsor0.43Buckland roadUnknownFront to rearClearDark-LightedDryNone2) Deming Street and the Existing Site Access DrivewayN/AN/AN/AN/AN/AN/AN/AN/AN/AN/AN/AN/AN/AUConn Crash Data Repository 240 Deming StreetSouth Windsor, Connecticut1/1/2020 - 12/31/20221) Buckland Road at Deming Street THE METRO REALTY MANAGEMENT CORPORATION 6 Executive Drive, Suite 100 | Farmington, CT 06032 www.metro-realty.com Affirmative Action / Equal Opportunity Employer June 16, 2023 Michele Lipe, Director of Planning Town of South Windsor 1540 Sullivan Avenue South Windsor, CT 06074 Re: 240 Deming Street (the “Property”) – Discussion of water, sewer and traffic circulation for the p roposed zone change from Buckland Road Gateway Development Zone (“GD”) to Multifamily Assisted Housing Zone (“MAHZ”) Dear Ms. Lipe, Pursuant to Section 7.22.2 A. of the South Windsor Zoning Regulations, when seeking a zone change to the MAHZ zone, the applicant shall submit a conceptual site plan describing the proposed development’s total number of residential units and their arrangement on the property, the proposed development roads and traffic circulation, sewage disposal and water supply. This letter serves to describe Metro Realty Management Corporation’s (the “Applicant”) plan for the Property’s roads and traffic circulation, sewage disposal, and water supply. The Property’s proposed internal roadways and circulation has been designed to accommodate the turning radius of the Town of South Windsor’s emergency vehicles. We hereby request that the Town Fire Marshall, or any other relevant department, review and confirm the adequacy of internal turning radii, as well as identify the final location of on-site fire hydrants. With respect to sewage disposal, the Applicant proposes to tie into the sewer main located in the northern shoulder of Deming Street, which is depicted in the Property and Topographic Survey prepared by Design Professionals, Inc. dated 4/17/2023 which was submitted with this application. Such connection would not require any construction in Deming Street. There is an existing 6” lateral that services the existing structure on the Property, and the Applicant proposes to tie into the sewer main at this location. Due to the grades at the property, the Applicant expects a pump station to be required. Attached as Exhibit A to this letter is a sewage capacity estimate prepared by SLR. The Applicant requests that the Superintendent of Pollution Control review this capacity estimate and the proposed tie-in location to determine preliminary feasibility or identify any sewage capacity concerns. Public water is also available in Deming Street, and SLR has submitted a will-serve request to CT Water on behalf of the Applicant for the proposed development. Sincerely, The Metro Realty Management Corporation By: __________________________________ Benjamin Tripp, EVP of Development Technical Memorandum 1 To: Ben Tripp From: Tom Daly Company: Metro Realty SLR International Corporation cc: Date: June 14, 2023 Project No. 141.13571.00069 RE: Sewage Generation Estimate Proposed Apartments 240 Deming Road South Windsor, Connecticut The estimated sewage generation for the proposed 72-unit apartments at 240 Deming Street is as follows: Housing Unit Unit Quantity Population Avg Flow (gpd) Per Unit Total One Bedroom 32 1.32 43 3,225 Two Bedroom 40 2.36 95 7,125 Subtotal: 72 138 10,350 NOTES: 1. Assume an average daily flow rate of 75 gallons per capita per day (gpcd) 2. Utilize Rutgers University, Center for Urban Policy Research Residential Demographic Multipliers, June 2006 updated by SCROG 13571.00069.jn1423.memo.docx Connecticut Water Company 93 West Main Street Clinton, CT 06413-1600 Office: 860.669.8636 Customer Service: 800.286.5700 June 27, 2023 The Metro Realty Group, Ltd. 6 Executive Drive, Suite 100 Farmington, CT 06032 Re: Water Feasibility – 240 Deming Street, South Windsor Dear Mr. Tripp: The Connecticut Water Company (CWC) recently received an inquiry regarding the ability to provide water service to a proposed multi-family residential development that includes seven (7) buildings with 8 or 12 units per building, totaling 112 bedrooms at 240 Deming Street. The proposed development has a projected average daily water demand of 10,800 gallons and a maximum day demand of 21,060 gallons. The proposed development is summarized in a Project Outline Form received by CWC on June 27, 2023 and detailed on the sheets titled “Existing Conditions” dated June 13, 2023. Based on the proposed details outlined above, domestic water and fire protection is available to your project. To provide such service, a properly engineered main extension may be required in accordance with the Regulations of Connecticut State Agencies. Design requirements shall be determined through planning and design efforts with the CWC. Additional infrastructure improvements may be required at your expense to meet the overall needs of your project. This letter does not represent approval of the design or submitted plans at this state of the project. Should a Customer Agreement for service not be executed within one year of the date of this letter, CWC reserves the right to reevaluate its ability to service this project. Furthermore, directly connected fire pumps are not permitted by CWC. Exceptions may only be granted with submission of a complete design and prior approval by CWC. As an alternative, you may be considering an on-site, domestic well. Please be advised that the Public Health Code prohibits the local Director of Health from issuing a water supply well permit for any premise located, or that will be located, on property whose boundary is within 200 feet of an existing community water system, when such distance is measured along a street, alley or easement. While the Code does provide for certain exceptions to this restriction, any such exception must be granted by the State Department of Public Health. If you have further questions regarding this letter please contact me at (203) 815-8769. If you have additional questions about your project, please contact Christopher Smegielski at (860) 202-4179. Respectfully, Lauren E. Bergman, PhD, P.E. Planning Engineer THE METRO REALTY MANAGEMENT CORPORATION 6 Executive Drive, Suite 100 | Farmington, CT 06032 www.metro-realty.com Affirmative Action / Equal Opportunity Employer June 29, 2023 Michele Lipe, Director of Planning Town of South Windsor 1540 Sullivan Avenue South Windsor, CT 06074 Re: Affordability Narrative for the proposed zone change of a portion of 240 Deming Street and 440 Buckland Road to Multifamily Assisted Housing Zone by Metro Realty Management Corporation (“Applicant”) Dear Ms. Lipe, As you are aware, the Applicant is seeking a zone change for a portion of the above-captioned properties from the Gateway Development zone to the Multifamily Assisted Housing Zone (“MAHZ”). The MAHZ requires that any development within the zone meet the definition of “assisted housing” under CGS 8-30g. This letter serves to describe the preliminary structure of affordability the Applicant intends to put in place for the proposed development in order to qualify as Assisted Housing. The Applicant intends to apply for 9% Low-Income Housing Tax Credits to finance the construction of the proposed development. To compete for these tax credits, we expect to deed-restrict 80% of the apartments in the development as affordable to individuals earning less than 80% of Area Median Income (“AMI”). That will include some apartments affordable at each of the following AMI levels: 30% AMI, 50% AMI, 60% AMI, and 80% AMI. The remaining 20% of the apartments will not be income-restricted and will be offered at a market rate rent. We also intend to reserve a portion of the development as Supportive Housing for individuals with intellectual disabilities through a program administered by the Department of Developmental Services. We have been working closely with MARC, Inc. of Manchester as a supportive service provider, and DDS as program administrator, for almost a year on this initiative. The exact affordability structure described above is subject to evolve if financing parameters specific to affordable housing change, but this is our best estimate of the affordability of the proposed development at this time. Notwithstanding, the proposed development will meet the definition of “Assisted Housing” under CGS 8- 30g, as required by the MAHZ regulation. Sincerely, The Metro Realty Management Corporation By: __________________________________ Benjamin Tripp, EVP of Development South Windsor Planning & Zoning 240 DEMING STREET July 11th, 2023 Proposed Zone Change for Portions of 240 Deming Street and 440 Buckland Road •In South Windsor, 5 developments, 434 apartments •Watson Farms •Hillcrest •Berry Patch I •Berry Patch II •The Residences at Oakland Road AFFORDABLE HOUSING EXPERIENCE AFFORDABLE HOUSING IN SOUTH WINDSOR •March 2022 – Moratorium on new residential applications •Inclusionary zoning, MAHZ broadened •Also in 2022, Affordable Housing Plan (8-30j) •Provided guidance for achieving goal of increased affordable housing AFFORDABLE HOUSING PLAN (“AHP”) The Site South Windsor Planning & Zoning 240 DEMING STREET July 11th, 2023 Site Location South Windsor Planning & Zoning 240 DEMING STREET July 11th, 2023 Site Location South Windsor Planning & Zoning 240 DEMING STREET July 11th, 2023 Conceptual site layout 1.14 acres South Windsor Planning & Zoning 240 DEMING STREET July 11th, 2023 NEIGHBORHOOD OUTREACH -Letters sent May 12th and June 23rd to abutters and residents of Grandview Terrace and Sele Drive -Meetings held May 18th, June 28th, and July 5th •Traditional Exterior •Two -story HOME-STYLE DESIGN •Direct Entrance •Private Outdoor Space HOME-STYLE DESIGN •Contemporary Interior •High-end interior finishes •Contemporary Interior •High-end interior finishes HOME-STYLE DESIGN Sustainability & Energy Efficiency Targets •DOE Zero Energy Home Ready Certification •LEED Gold •Balanced ventilation •High-efficiency heating, cooling and hot water systems •Home Energy Rating System (“HERS”) rating <42 (35% below Energy Start Index) •Photovoltaic to power common elements South Windsor Planning & Zoning 240 DEMING STREET July 11th, 2023 Affordability CHFA Financing – Highly Competitive •9% LIHTCs: extremely competitive •Applications accepted once annually (January) •Applications are scored using the Qualified Allocation Plan (“QAP”) – transparent process •Metro highly-experienced affordable housing developer •18 LIHTC developments, ~1,500 apartments •434 of the 663 (65%) of the assisted housing units in South Windsor •240 Deming Street will score highly under the current QAP South Windsor Planning & Zoning 240 DEMING STREET July 11th, 2023 MARC INC., OF MANCHESTER TRAFFIC STUDY •New traffic counts conducted in June, 2023 •Background traffic growth included: •1% growth rate per year •Evergreen Walk and Gateway Development traffic •Site generated traffic •Industry standard ITE rates utilized •Residential development is a low traffic generator •Weekday AM Peak Hour – 25 trips •Weekday PM Peak Hour – 28 trips •Saturday Midday Peak Hour – 28 trips •Alternative uses analyzed – Medical Office and Restaurant/Coffee Shop TRAFFIC STUDY •Capacity Analysis Results •No change in Level of Service at Buckland/Deming intersection •No noticeable change in vehicle delays •Queue increases less than one vehicle length on all approaches •Intersection Sight Distances •Exceed CTDOT criteria for safe driveway egress •Crash History •No abnormal crash patterns or frequency in study area •No crashes reports on Deming Street near site frontage •Conclusion: •Proposed development will have no significant impact to traffic operations or safety in the study area South Windsor Planning & Zoning 240 DEMING STREET July 11th, 2023 THANK YOU APPENDIX •Temporary Moratorium vs. 10% goal •Housing equivalency points for a temporary moratorium Vs. •1 to 1 value for all apartments within an “Assisted Development” toward the 10% goal. AFFORDABLE HOUSING OVERVIEW •Temporary Moratorium vs. 10% goal •Housing equivalency points for a temporary moratorium Vs. •1 to 1 value for all apartments within an “Assisted Development” toward the 10% goal. AFFORDABLE HOUSING OVERVIEW ASSISTED HOUSING CALCULATIONS ASSISTED HOUSING CALCULATIONS *Based on 2022 Affordable Housing Appeals List published by Connecticut Department of Housing School-Aged Children -At 175 Oakland, has varied between 6 to 14 students since construction -Per South Windsor BOE, most recent numbers show 8 to 10 students registered with SW public schools -At with 78 apartments, 10 students equates to 1 student for every 7.8 apartments -This coincides with data from our other non-age restricted multifamily developments, typically 1 student for every 8 to 12 apartments ARCHITECTURE 175 Oakland Road To: From: Re: Date: MEMORANDUM South Windsor Planning and Zoning Commission Richard D. Carella, Town Attorney Petition against zone change at 240 Deming Street and 440 Buckland Road August 8, 2023 QUESTION PRESENTED At a prior meeting of the Town of South Windsor (“Town”) Planning and Zoning Commission (“Commission”), thirteen (13) property owners (“Petitioners”) submitted a signed petition (“Petition”) in opposition to the zone change proposed by The Metro Realty Management Corporation (“Applicant”). Connecticut General Statutes § 8-3(b) provides: [i]f a protest against a proposed change is filed at or before a hearing with the zoning commission, signed by the owners of twenty per cent or more of the area of the lots included in such proposed change or of the lots within five hundred feet in all directions of the property included in the proposed change, such change shall not be adopted except by a vote of two-thirds of all the members of the commission. The question is whether the Petition meets the requirements of § 8-3(b). If so, a two-thirds supermajority vote is required to approve Applicant’s proposed zone change. BRIEF ANSWER The Petition, which is attached as Exhibit A, does not satisfy the requirements of § 8-3(b), which would trigger a two-thirds supermajority vote to approve the proposed zone change. The total area of Petitioners' properties within 500 feet of the proposed zone change does not exceed the 20 percent threshold required by statute. See Exhibit B, which is a Zone Change Map prepared by SLR for the proposal. That map identifies the properties within 500 feet of Applicant’s proposed zone change. DISCUSSION A petition submitted under § 8-3(b) can be signed by property owners residing within 500 feet of the proposed change. See Pond View, LLC v. PZC of Monroe, 288 Conn. 143, 162 n. 15 (2008). Such a petition “is not presumptively valid. A commission may conclude either that such a petition is valid or that it is invalid.” Blaker v. PZC of Fairfield, 219 Conn. 139, 148 (1991). If the petition 1 is found to be valid, a zone change cannot be approved unless by a vote of a two-thirds supermajority of the Commission. The Petition included the signatures of thirteen (13) property owners. Of these thirteen, the following five (5) properties are not within 500 feet of the proposed zone change. See Exhibit B. • 8 Grandview Terrace (Tetreault Napoleon A III & Jennie L) • 28 Grandview Terrace (Plein William J & Cosme Clara) • 301 Deming Street (Sanghani Kamlesh V) • 35 Grandview Terrace (Raviwongse Anuwat Nan) • 32 Sele Drive (Margiott Paul R & Victoria A M) The above five properties were, therefore, not included in the statutory calculation of lot area within 500 feet of the proposed zone change area. The below eight (8) properties in Figure 1 are within 500 feet of the proposed zone change. FIGURE 1___________________ Lots within 500’ of zone change 241 Deming St________________ 247 Deming St________________ 260 Deming St________________ 285 Deming St________________ 15 Grandview Terr____________ 25 Grandview Terr____________ 20 Sele Dr____________________ 33 Sele Dr Total lot size (acres) 0.76______________ 0.72______________ 1.19______________ 0.69______________ 1.41_______________ 1.73_______________ 1.52______________ 1.82 Lot area within 500’ (acres) 0.76_____________________ 0.72_____________________ 1.19_____________________ 0.004____________________ 1.41______________________ 0.06_____________________ 1.14_____________________ 0.28 Total 5.564 acres The total area within 500 feet of the proposed zone change is 35.54 acres. Twenty percent of 35.54 is 7.1 acres. Petitioners, therefore, must have obtained signatures from owners totaling an area of at least 7.1 acres to meet the statutory requirement of § 8-3(b). However, the total lot area of the properties included in the Petition within 500 feet of the proposed zone change, as reflected in Figure 1, is only 5.564 acres. CONCLUSION Petitioners fall short of the 20 percent threshold prescribed in General Statutes § 8-3(b) and, accordingly, the Petition is not valid. A two-thirds supermajority vote is not necessary to approve Applicant’s proposed zone change. 2 EX.c Petition against Zoning Change from Buckland Gateway Development Zone to Multifamily Assisted Housing We the undersigned protest the proposed zoning amendments for the Buckland Gateway Development Zone set forth in application 23-25P submitted by The Metro Realty Management Corporation received by the South Windsor Planning and Zoning Committee May 23, 2023. We are owners of twenty per cent of the lots within five hundred feet in al) directions of the property included in the proposed change. We understand the proposed changes shall not be adopted except by a vote of two-thirds of all the members of the commission. The applicant name and summary description of the proposed rezoning is as follows: Name/Description: The Metro Realty Management Corporation — request for a zone change ofapprox. 4.82 acres from Buckland Gateway Development Zone to the Multifamily Assisted Housing (MAHZ)” to include a portion of 240 Deming Street (4.82 ac) and a portion, of 440 Buckland Road (.36 ac), including conceptual plan in accordance with Sec 7.22.2.A. CRUZ RAUL PROPERTY WITHIN 500 FEET • 241 DEMING STREET SOUTH WINDSOR, CT 06074 TETREAULT NAPOLEON A III & JENNIE L PROPERTY WITHIN 500 FEET 8 GRANDVIEW TERRACE SOUTH WINDSOR,ZCT06074 SIGNATURE SIGNATURE SIGNATURE DATE 2Jun09-0:3 DATE (o LLen/ea4c 28203 GLOVER MARGARETA PROPERTY WITHIN 500 FEET ; 247 DEMING STREET SOUTH SIGNA PASQUALONI PAULTR PROPERTY WITHIN 500 FEET 15 GRANDVIEW TERRACE SOUTH WINDSOR, CT06074 SIGNATURE DATE DATE 2023 I PHO LOC H & TAWNY PROPERTY WITHIN 500 FEET 260 DEMING STREET FARACI BRIAN & CARIN PROPERTY WITHIN 500 FEET 25 GRANDVIEW TERRACE SOUTH WINDSOR, CT 06074 SIGNATURE SIGNATURE DATE y, 7uf SOUTH WINDSOR, CT 06074 SIGNATURE SIGNATURE ((29/23 DATE RAJU UDAI K & PROPERTY WITHIN 500 FEET PLEIN WILLIAM J & COSME CLARA ' PROPERTY WITHIN 500 FEET 28 285 DEMING STREET SOUTH WINDSOR, CT 06074 GRANDVIEW TERR SOUTH WINDSOR, CT 06074 SIGNATURE SIGNATURE C2eetg C6zl@ SIGNATURE DATE DATE nkeg22. -08’ -23 SANG HAN I KAMLESH V RAViWONGSE ANUWAT NAN PROPERTY WITHIN 500 FEET PROPERTY WITHIN 500 FEET 301 DEMING STREET SOUTH WINDSOR, CT 06074 35 GRANDVIEW TERRACE SOUTH WINDSOR, CT.06074 SIGNATUREE (0uu(ou DATE ^23] io 13 SIGNATURE DATE BASILE MARK T & ROBERTA L PROPERTY WITHIN 500 FEET 20SELE DRIVE SOUTH WINDSOR CT 06074,----, SIGNATURE SIGNATURE DATE 7/5/23 ATTIANESE VINCENT & ANTONINA C PROPERTY WITHIN 500 FEET 33 SELE DRIVE SOUTH WINDSOR, CT06074 SIGNATURE Zuc77 SIGNATUREOEOUNaO(EbcNRSE. DATE 3 MARGIOTT PAUL R & VICTORIA A M PROPERTY WITHIN 500 FEET 32 SELE DRIVE SOUTH WINDSOR' SIGNATURE 303<6p74-_2A(70/6 DATE 7/—77 6/19/23, 12:58 PM Print Map wdO=e https://southwindsor.mapxpress.nel/ags_map/1/1 TOWN OF SOUTH WINDSOR, CONNECTICUT - Adjoining (500 ft) Count 1 Parcel ID ~~3200050 Site Address 50 ANDREWS WAY 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 15300340 15300350 15300350 15300419 15300432 15300440 17850100 27600176 27600200 27600235 27600240 27600241 27600247 27600260 27600285 27600301 31301000 340 BUCKLAND ROAD 350 SUCKLAND ROAD 350 BUCKLAND ROAD 419 BUCKLAND ROAD 432 BUCKLAND ROAD 440 BUCKLAND ROAD 100 CEDAR AVENUE 176 DEMING STREET 200 DEMING STREET 235 DEMING STREET 240 DEMING STREET 241 DEMING STREET 247 DEMING STREET 260 DEMING STREET 285 DEMING STREET 301 DEMING STREET 1000 EVERGREEN WAY Owner Name_________ _________ ______ SOUTH WINDSOR DEVELOPERS LLC J HANNOUSH FAMILY OF SOUTH WINDSOR LLC BUCKLAND COMMONS LLC BUCKLAND COMMONS LLC____________ CARMON & COMPANY LLC KRE BSL HUSKY BUCKLAND LLC BERRY PATCH II ASSOCIATES LIMITED BARTLETT & STAGE LLC WINDSOR FEDERAL SAVINGS AND south Windsor’farms propco llc ASTICOU INVESTMENT LLC___________ CALVARY CHURCH OF THE ASSEM B L IES CRUZ RAUL GLOVER MARGARETA___________________ PHO LOC H & TAWNY RAJU UDAI K &_____________ SANGHANI KAMLESH V _______ CD-HRA (WINDSOR)'LLC Mailing Address 145 HUDSON ST STE 6C 122 ELM STREET 1744 ELLINGTON ROAD 1774 ELLINGTON ROAD TO BOX 6 PO BOX 92129_____________ 6 EXECUTE DCWE ~ 7500 E MCDONALD DR 250 BROAD STREET '315 NORWOOD PARK SOUTH 1744 ELLINGTON ROAD ” 240 DEMING STREET 241 DEMING STREET 247 DEMING STREET ,260 DEMING STREET ' 285 DEMING STREET 301 DEMING STREET 2240 BLAKE ST STE 200 Mailing City NEW YORK Mailing State NY Malling Zip _ 10013-0000 ENFIELD_________ SOUTH WINDSOR SOUTH WINDSOR WINDSOR SOUTHLAKE FARMINGTON ~ SCOTTSDALE WINDSOR_______ NORWOOD SOUTH WINDSOR SOUTH W NDSOR SOUTH WINDSOR SOUTH WINDSOR SOUTH WINDSOR SOUTH WINDSOR SOUTH WINDSOR DENVER CT CT CT CT TX CT ' AZ CT MA CT CT Er CT ’CT CT CO 06082- 0000 06074-0000 06074-0000 06095-0000 76092-0000 C6O32- 0000 85250-0000 06095- 0000 02062-0000 06074-0000 06074-0000 06074- 0000 06074- 0000 06074- 0000 06074-0000 06074-0000 80205-0000 19 20 21 22 7.3 24 25 26 2 7 28 29 30 31 32 33 34 35 36 31300000 37700008 37700015 37700025 37700028 "37700035 41350900 54651000 54651200 65700205 81770010 81800020 81800032 81800033 89302400 89302701 89302800 89300035 EVERGREEN WAY 8 GRANDVIEW TERRACE 15 GRANDVIEW TERRACE 25 GRANDVIEW TERRACE 28 GRANDVIEW TERRACE 35 GRANDVIEW TERRACE 900 HEMLOCK AVENUE 10O0 LONG LEAF LANE____ 1200 LONGLEAF LANE 205 OAKLAND ROAD 16 SEDONA CIRCLE'_____ 20SELE DRIVE_________ 32 SELE DRIVE 33 SELE DRIVE 2400 TAMARACK AVE NU E 2701 TAMARACK AVENUE 2800 TAMARACK AVENUE 35 TAMARACK AVEN UE EVERGREEN WALK LIFESTYLE CENTER LLC TETREAULT NAPOLEON A III & JENNIE L PASQUALONI PAULTR FARACI BRIAN & CARIN ” PLEIN WILLIAM J & RAVIWONGSE ANUWAT NAN WSL-EVERGREEN CROSSING LLC HHD SOUTH WINDSOR LLC RHP SOUTH WINDSOR LLC___________ BERRY PATCH ASSOCIATES LP _ 10 SEDONA CIRCLE- BASILE MARK T & ROBERTA L MARGIOTT PAUL R & VICTORIA A M ~ ATTIANESE VINCENT & ANTONINA C EVERGREEN MEDICAL ASSOCIATES I! LLC AGM PROPERTIES LLC EVERGREEN MEDICAL ASSOCIATES LLC BUCKLAND ROAD RETAIL LLC 501 EVERGREEN WAY STE 503 8 GRANDVIEW TERRACE 15 GRANDVIEW TERRACE 25 GRANDVIEW TERRACE 28 GRANDVIEW TERR 35 GRANDVIEW TERRACE 660 STEAMBOAT RD 3RD FLOOR ' 405 ROTHROCK RD SUITE 8102 4520 EVERHARD ROAD 4147 6 EXECUTIVE DRIVE STE 1000’ 570 PIERMONT RD STE #120 _ 20 SELE DRIVE 32 SEIE DRIVE 33 SELE DRIVE 16435 N SCOTTSDALE RD STE 320 23 PEASE FARM RD 16435 N SCOTTSDALE RD STE 320 501 EVERGREEN WAY STE 503 SOUTH WINDSOR SOUTH WINDSOR SOUTH WINDSOR SOUTH WINDSOR 'SOUTH WINDSOR SOUTH WINDSOR GREENWICH ' COPLEY ' CANTON_________ FARMINGTON 'CLOSTER SOUTH WINDSOR SOUTH WINDSOR ' SOUTH WINDSOR SCO I IS DALE___ ' ELLINGTON SCOTTSOALE ' SOUTH WINDSOR CT CT CT CT CT CT OH OH CT NJ CT CT CT AZ CT AZ 06074- 0000 ’ 06074- 0000 ’ 06074-0000 ' 06074- 0000 06074-0000 06074-0000 ’ 06830- 0000 ' 44321- 0000 44 /18- 0000 ' 06032- 0000 07624-0000 '06074- 0000 06074- 0000 06074- 0000 '85254-0000 06029- 0000 85254- 0000 06074- 0000 I fi i /)u Q 55 2 154 i r P AA30 LIMITED RESIDENITIAL GD GATEWAY DEVELOPNENT 33S4L DMIVE RESTRICTED COMMERCIAL RR] RURAL RESIDENTIAL MAP NOT E::ki TA1AAFMC 25 5PANDVIW RC] 340 TAMWAFMG 27-35-15 N/A cy B 07—""'p MAH2 MULTI-FAMILY ASSISTED HOUSING RESIDENTIAL/CCI-IMERCIAL INFORMATION COMPILED FROM AVAILABLE TOWN OF ' SOUTH WINDSOR GIS INFORMATION ON MAY 2, 2023 AND SHOULD BE CONSIDERED APPROXIMATE. 3 LOCATION MAP: 3A0POEFTYOVIEAS w tM $11 r ‘“9 zr I - QM 58 U = SQAN 2NEW:WaY S40BULALANDMOAL I5OBUOXLANDROAC OUOLANONOD WBUCILANDRCAD 100CEDARAVBNU TOJOtAMIG STREET B3SOEMNGSTREEI 241D6MNGSTRELL 43DUNINGSTHEIT 100DtNWGSTNEET raSOtAWIGSTREET IVIRCRCINWay OWGLFRSNAMFAICMAIINGADORESS tri u-f WInNIR NFUFIO:FG . 11 r 145 1 l-AffllOUlH I AMI' Of »OUT» MtlOSOt EN/ILLUCIUG3L 8LO-auDcOMOH5IC ” 174tLL146TC110aD SCUT-IIWINIDSORCTO6074 CaRwon accMranY UC WNIGTRCI D-K «« Kl U2% atcilaud ucro BOX 9213 SCUIILA*CT769: EENh PATCH AA33CCIATE3LMITEO 6ExEcUnIV:DHIVE FAAMINSTONCTX032 8AATLETTES14G:LIC 7S30LNCOONHALOD scors0a1A2812:0 wt SCR IE OIR.1 sW N SS a N 0 WWCSCRCTOSOS scut- WINDSOAEAaN* eno3co lie 3331OTMCOD Fane sou I 20G0EVEIGHEM w: NORWOGOI oxe: 17u(UNCTCNROAD SCUTI WINDSORCTGCRJZ RAUL 2410:1 ETREET SCUH WIHDS3RCT 06074 GIOVER M-RGART » SOUr-IWiOsOAST CM!'. PIO ioCH* iAw 2630:10 ‘NLCI ICUr "IDSONCT 06074 2BSD3MNGS‘REST SCUHIWINDSDR CT 06:4 EVRGREENWAI U’ESTYIE CENIEE lit SOI tn'.SMtU WAS SIE SU scull V.1M1$3RCTO6<74 CCMAAIWNtiSCRl.lC 70UIUKCSTSHX0 r OWIVIRCOEO20: pascajaonirauLi p0MrOMEw tuMa MUI1WIIWDJKOIUWU/G FaAAIGRIaNGLANIN 2SGHANOMEWTERFAG SCUTIWINOSORCT 06074 WL-IVERCAEINCROSSINGLIC 663S‘EAMOAI IDSACFIOCR WfltMOCK AVHiW IGEFFNWICNC 064» 100LNGLCAT LJIE IAUUM>UAt LANE 2030aKLANDKO:D • 5 at renGEII WAU e(EVERGREENWALX unin lit ■vtaafEiH Mir. OKEVEAGAEETWaU 325 sit r.imjun Mir see IVIRCAEI1: MIx 173 # H I # 8 3 6I mmeniwNrSOHI r 103 ROTHEOO Au SUIT 102 Iccruy 0n44121 no:oumWNE3CAL.C 43101VEKIURD NOND-14’ UNIUNONH/1: BEMR'PAKH as"QAIESLP 6 EXtCU’IVi DaIVE SIE 1000 FAAN/INSTON: S I 0sEDOvaCI.CLE SHPIERUCNTRESTEM2 zoseu DRIVE scut ivnnciSjncroUM AMANIESE aucers alo:I ( scur 1VNOSORCIC60/4 8UCk.ATIDNOADRETAI.IIC SOI t VEFGREEN wa sit $s 15 tALMaACK AVENUE SOUT 1 VINDSORCT06074 ;xo IAMMAHAC IVEAGRE:NWLIK EVERGREEN MEOACA: A3SCCiaTEs n tu 16235 H scorisoau ROSIE scorsn41A/R.354 ACM BAOPIRnEsu: ELISTOnIcTC0U29 evERUAIEIIMIDNI:ALASSCCIATbLIC 1615 n scorsDalE ro sit no soorscaLa2ss25:EVER AIEN wav OlEVERGREEN WAL st IVERGHININAIK ML-. sat tvewnttI MALK 2LUg O UJ 2 O N RYE O(EVEAGAEENWALA SEELVERGAEINNALK O(EVERGALENWAU OIEV:NCNtENWaLK SiE IVIRCREIN NALK ste IVtRGNEIN WAL OIEVERGREENWAL: Will SIE EVERGREEN MJ. Z LU = 0 O in& □ s — s | LCD J 1"=100 MAY 10, 202 13571,0006! zc 1 4074737 MEMORANDUM To: South Windsor Planning and Zoning Commission From: Richard D. Carella, Town Attorney Re: Petitions for Intervenor status under General Statutes § 22a-19 Date: August 10, 2023 ______________________________________________________________________________ QUESTION PRESENTED At a prior meeting of the Town of South Windsor (“Town”) Planning and Zoning Commission (“Commission”), three individuals, Loc Pho, Margaret Glover, and Paul Pasqualona, (“Petitioners”) submitted “verified petitions” for intervention in an administrative proceeding pursuant to General Statutes § 22a-19 (“Petitions”). The proceeding at issue is the application for zone change (“Application”) proposed by The Metro Realty Management Corporation (“Applicant”). Petitioners argue that the Application “involves conduct which has or which is reasonably likely to have, the effect of unreasonably polluting, impairing, or destroying the public trust in the air, water and other natural resources of the state . . . .” Petitions, p. 1. You have inquired if such Petitions are sufficient under Connecticut law. BRIEF ANSWER Insofar as the Application at issue is a zone change application and does not by itself permit a particular development project, the Petition does not implicate a “proceeding” that “has, or which is reasonably likely to have, the effect of unreasonably polluting, impairing or destroying the public trust in the air, water or other natural resources of the state.” General Statutes § 22a-19. As such, the Petitioners lacks standing, and the Commission should not grant intervenor status to Petitioners. DISCUSSION The Connecticut Environmental Protection Act (“CEPA”) allows any person, corporation, partnership, entity, or any other organization to intervene in a “proceeding” before an administrative body such as, in this case, the Commission. See General Statutes § 22a-19. A proceeding can qualify as any public hearing before the Commission. See AvalonBay Communities, Inc. v. Zoning Commission of Stratford, 280 Conn. 405, 414 (2006) (noting that repeated use of the word “any” indicates an intent to allow “the broadest possible range of parties to intervene in an expansive spectrum of proceedings.”). However, standing under section 22a-19 requires that the conduct at issue in the application threaten to cause harm to the environment. See Pond View, LLC v. PZC of Monroe, 288 Conn. 143, 160 (2008). 2 4074737 An application for a zone change does not amount to conduct that threatens the environment. The Connecticut Supreme Court’s decision in Pond View, LLC v. PZC of Monroe, 288 Conn. 143 (2008), is dispositive. In Pond View, the Court held that the CEPA does not confer standing on would-be environmental intervenors in an application for a zone change. Id. at 159- 60. The Supreme Court noted that the conduct of actually developing the property (as opposed to the zone change) would potentially cause the requisite environmental harm under the statute. Therefore, the Court reasoned, “to the extent that the intervenors want to challenge the environmental impacts of the construction of the shopping center and related procedural issues that are within the commission's jurisdiction to consider, the proper forum for such challenges is their appeal from the commission's decision granting the plaintiff's special exception permit or, more specifically, approving the site plan.” Id. at 161. It is the special permit application, involving a concrete site plan, “that involves the actual conduct that ultimately and allegedly could have unreasonable environmental effects.” Id. at 154. Petitioners seek to intervene in a proceeding before the Commission concerning an application for a zone change. This is a legislative action, rather than an adjudicative one, that does not, in and of itself, implicate conduct that would threaten the environment. See Douglas v. Planning & Zoning Commission, 127 Conn. App. 87, 107 (2011) (“The inclusion of environmental issues in the complaint does not per se provide the intervening plaintiffs standing under § 22a–19 or allow them to avoid application of our court's holding in Pond View, LLC. The language in Pond View, LLC, clearly states that a zone change is a legislative action which does not directly threaten the environment”). CONCLUSION Based on the holding in Pond View, LLC, the Commission should not grant Petitioners the right to intervene in the proceeding under § 22a–19 associated with this Application for a zone change. 1 4072780 MEMORANDUM To: South Windsor Planning and Zoning Commission From: Richard D. Carella, Town Attorney Re: Allegations of bias of Commission member Date: August 10, 2023 ______________________________________________________________________________ QUESTION PRESENTED At a prior meeting of the Town of South Windsor (“Town”) Planning and Zoning Commission (“Commission”), twenty-three (23) persons (“Petitioners”) submitted a signed petition (“Petition”) requesting that a member of the Commission, Alan Cavagnaro (“Cavagnaro”), recuse himself from deliberating on the application for zone change (“Application”) proposed by The Metro Realty Management Corporation (“Applicant”). The basis for the Petition is that Cavagnaro has “a major role for a group that lobbies for affordable housing. [Petitioners] believe that this commissioner will be unable to be impartial” regarding Applicant’s proposed zone change. BRIEF ANSWER Without additional allegations of personal interest or predetermination, there is no basis for Cavagnaro’s disqualification. If additional facts arise, this can be reassessed. DISCUSSION A. Personal interest Connecticut General Statutes § 8-11 provides that “[n]o member of any zoning commission or board . . . shall participate in the hearing or decision of the board or commission of which he is a member upon any matter in which he is directly or indirectly interested in a personal or financial sense.” “A personal interest is either an interest in the subject matter or a relationship with the parties before the zoning authority impairing the impartiality expected . . . . A personal interest can take the form of favoritism toward one party or hostility toward the opposing party; it is a personal bias or prejudice which imperils the open-mindedness and sense of fairness which a zoning official in our state is required to possess.” Anderson v. Zoning Commission, 157 Conn. 285, 290–91 (1968). 2 4072780 Additionally, there is a presumption that land use board members are not biased. “To overcome the presumption, the plaintiff . . . must demonstrate actual bias, rather than mere potential bias, of the board members challenged, unless the circumstances indicate a probability of such bias too high to be constitutionally tolerable . . . . The plaintiff has the burden of establishing a disqualifying interest.” (Citations omitted; internal quotation marks omitted.) O & G Industries, Inc. v. Planning & Zoning Commission, 232 Conn. 419, 429-30 (1995). “The decision as to whether a particular interest is sufficient to disqualify is necessarily a factual one and depends on the circumstances of the particular case.” Id. at 291; Gaynor-Stafford Indus., Inc. v. WPCA of Stafford, 192 Conn. 638, 650 (1984). The critical factual question is the nature of Cavagnaro’s alleged interest in the Application. See Timber Trails Assocs. v. PZC of Sherman, 99 Conn. App. 768, 765-76 (2007) (declining to overturn trial court’s decision that no bias afflicted a commissioner because trial court failed to undertake this predicate factual finding). Here, the Petition alleges that Cavagnaro “has a major role for a group that lobbies for affordable housing.” Cases in which a commission member has been successfully challenged under this standard have generally turned upon a finding that something unique about the commission member's own land. See e.g., Lake Garda Imp. Ass'n v. Town Plan and Zoning Commission of Farmington, 151 Conn. 476 (1964) (commission chair not only was member of rival association, but was a friend and business associate of the chief antagonist to plaintiff's proposal); Thorne v. Zoning Commission of the Town of Old Saybrook, 178 Conn. 198 (1979) (proposed zone change had effect upon property belonging to family members of commission chair). These circumstances are not present here. A commission member’s perception of what policies best serve the general welfare, health, morals, or safety of the community is not a disqualifying personal interest. See e.g., Furtney v. Simsbury, 159 Conn. 585 (1970) (upholding zone change vote when commissioner had been known to be in favor of the change but had never taken a definite and inalterable position on such change, therefore he was not found to have made up his mind prior to the hearing); Holt-Lock, Inc. v. PZC of Granby, 161 Conn. 182 (1971) (holding that a commissioner was not disqualified when the commissioner was a member of the Granby conservation commission, which opposed the applicant’s request for a special permit). “The law does not require that members of [land use] commissions must have no opinion concerning the proper development of their communities.” (Internal quotation marks omitted.) Woodburn v. Conservation Commission, 37 Conn. App. 166, 175, cert. denied, 233 Conn. 906 (1995). Here, Petitioners seek recusal based on Cavagnaro’s political and policy orientation on a matter of general applicability (i.e., affordable housing) and that such an orientation presents a disqualifying personal interest in the Application for a zone change. As an elected official, Cavagnaro has expressed his views on affordable housing in the public sphere but has not indicated that he has prejudged the Application, a zone change, or any further action related to Applicant’s proposed development. Like all commissioners, the Town expects Cavagnaro to keep an open mind and vote based on the evidence presented at the public hearing. 3 4072780 B. Predetermination Allegations of predetermination differ slightly from those of personal interest. It is a claim that a particular member of a land use agency is so closed minded that she reached a decision on the matter prior to the public hearing regardless of the evidence presented. As such, this claim requires a slightly different analysis. “Our Supreme Court has held that disqualification is required in the face of . . . [allegations of predetermination] if the commission members whose partiality is challenged actually had made up their minds prior to the public hearing, regardless of any arguments that might have been advanced at the hearing.” (Internal quotation marks omitted.) Id.; see also Furtney v. Simsbury, 159 Conn. 585, 594 (1970)(holding that no evidence was presented establishing commissioner had prejudged application for zone change). The burden of proving a commissioner's partiality and prejudgment is on the plaintiff. Id. Petitioners do not offer any facts other than Cavagnaro’s involvement with a group that promotes affordable housing. This allegation, in and of itself, is insufficient to warrant Cavagnaro’s disqualification. This is particularly so in light of the presumption that administrative board members are not biased. O & G Industries, Inc. v. Planning & Zoning Commission, supra, 232 Conn. 429-30. CONCLUSION Absent additional facts, there is no evidence that Cavagnaro (1) has a disqualifying personal interest in the Application or (2) has prejudged the Application prior to the public hearing. Accordingly, there is an insufficient basis for disqualification. 136138140142144146148150152154156158160162164166168170172174170168166164162160158156154152150148146144142140138136134132130128126124122120116116118120122124124124126128130132134136138136138124126128130132134136138140132134136This Drawing Produced by the U.S. Access Board This Drawing Produced by the U.S. Access Board This Drawing Produced by the U.S. Access Board This Drawing Produced by the U.S. Access Board This Drawing Produced by the U.S. Access Board This Drawing Produced by the U.S. Access BoardTW=146.0BW=145.5TW=145.5BW=138.0TW=141.0BW=135.5100' UPLAND REVIEW AREAFF=137.50FF=136.80FF=135.80FF=134.50FF=133.90FF=133.90FF=134.90FF=135.80FF=136.80FF=137.80FF=134.50FF=133.50FF=138.50FF=139.50122124126128130132134132130128126136134132130134136126128130132134138138138138136134134133134133136136136138136135137138140142144146148150140140SHEET NAMEDATEGRPROJECT NO.DESIGNEDRYESCALEDRAWNLCDCHECKEDRYEAUGUST 8, 202313571.000691"=40'CONCEPTUAL GRADING PLANSOUTH WINDSOR, CONNECTICUTMULTI-FAMILY DEVELOPMENT 240 DEMING STREETSHEET NO.DESCRIPTIONBYDATE0'20'40'01/2"1"Copyright SLR International Corporation - 2021SWNE99 REALTY DRIVECHESHIRE, CT 06410203.271.1773SLRCONSULTING.COMPROPOSED CONTOUREXISTING CONTOUR PROPOSED SPOT ELEVATIONEXISTING SPOT ELEVATION70.57070.5TC 120.0BC 119.5124TOP OF CURBBOTTOM OF CURBGRADING LEGEND: This Drawing Produced by the U.S. Access Board This Drawing Produced by the U.S. Access Board This Drawing Produced by the U.S. Access Board This Drawing Produced by the U.S. Access Board This Drawing Produced by the U.S. Access Board This Drawing Produced by the U.S. Access Board ABCED24'24'20'8'20'8'8'65'25'25'25'GAZEBOPATIO/DECK (TYP.)DUMPSTERPAD (TYP.)PROPOSED BUS SHELTER50'PROPOSEDCONSERVATIONEASEMENT LINEPROPOSED CONSERVATIONRESTRICTION AREA± 1.14 AC9'24'2 STORY(12 UNIT)BUILDING2 STORY(12 UNIT)BUILDING2 STORY(8 UNIT)BUILDING2 STORY(12 UNIT)BUILDINGGRILLINGAREA3DEMING STREET1077875596874AGAGAGAGAGAGAGAAAAAAAAAAPLPLPLPLPLPLPLPLPLPLPLPLPLBDBDBDBDBDBDBDBDBDBDBDBDBDBDAABDBDBDBDPLPLAGTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCPAPAPAPAPAPAPAPAPAPAPAPAPAPAPAPAPAPAPAPAPAPAPAAOAOAOAOAOAOAOAOAOAO50'2 STORY(11 UNIT ANDCOMMUNITY ROOM)BUILDINGSITESHEET NAMEDATELAPROJECT NO.DESIGNEDRYESCALEDRAWNRYECHECKEDRYEAUGUST 8, 202313571.000691"=40'CONCEPTUAL LAYOUT AND LANDSCAPING PLANSOUTH WINDSOR, CONNECTICUTMULTI-FAMILY DEVELOPMENT 240 DEMING STREETSHEET NO.DESCRIPTIONBYDATE0'20'40'01/2"1"Copyright SLR International Corporation - 2021SWNE99 REALTY DRIVECHESHIRE, CT 06410203.271.1773SLRCONSULTING.COMREQUIREMENTREQ'D/PERMITTEDPROVIDEDMINIMUMTOTAL LOT AREA (S.F., AC.)174240 (4 AC.)275,515 (6.324 AC.)*FRONT YARD (FT.)5065SIDE YARD (FT.)2525 / 50REAR YARD (FT.)2525MAXIMUMBUILDING HEIGHT (FT.)35BUILDING COVERAGE (%)2511IMPERVIOUS COVERAGE (%)6030ZONING DATA TABLEREQUIREMENTREQ'D/PERMITTEDPROPOSEDTOTAL SPACES83 SPACES86 SPACESHANDICAP SPACES4 SPACES6 SPACESREQUIRED PARKING TABLELOCATION MAP:0'500'1000'SCALE 1" = 1000'01/2"1"LOCATION MAP:0'500'1000'SCALE 1" = 1000'01/2"1"LOCATION MAP:0'500'1000'SCALE 1" = 1000'01/2"1"*INCLUDES 1.13 AC TO BE PLACED INTO CONSERVATION AIA HINCKLEY ALLEN 20 Church Street Hartford, CT 06103 p: 860-725-6200 f: 860-278-3802 hinckleyaElen.com Timothy S. Hollister (860) 331-2823 (Direct) (860) 558-1512 (Cell) thollister@hinckleyallen.com August 10, 2023 VIA HAND DELIVERY AND EMAIL TO M. LIPE at Michele.Lipe@southwindsor-ct.gov Chair Bart Pacekonis, and Planning and Zoning Commission Members Town of South Windsor 1540 Sullivan Avenue South Windsor, CT 06074 Michele Lips, Town Planner Town of South Windsor 1540 Sullivan Avenue South Windsor, CT 06074 Re:Application of Metro Realty for Rezoning of 240 Deming Street and part of 440 Buckland Road Dear Chair Pacekonis, Commission Members, and Ms. Lipe: We are writing on behalf of Metro Realty to address three "petitions" filed with the Commission at the public hearing on July 25, 2023: (1) a petition to disqualify Commissioner Alan Cavagnaro on the asserted basis of "predetermination", (2) an environmental intervention petition filed under General Statutes § 22a-19 by Margaret Glover, Paul Pasqualoni, and Loc Pho, and (3) a so-called "protest petition," ostensibly prepared under General Statutes § 8-3(b), aiming to require a two-thirds supermaj rarity vote to approve the zone change. Each of these petitions is factually and legally deficient, as explained below : Section §22a-19 intervention petitions The application before the Commission is to rezone five acres of land. There is no site plan application at this time. General Statutes § 22a-19 allows intervention when a proceeding or action for judicial review "involves conduct which has, or which is reasonably likely to have, the effect of unreasonably polluting, impairing or destroying the public trust in the air, water, or other natural resources of the state" (emphasis added). WALBANY BOSTON CHICAGO HARTFORD MANCHESTER NEW YORK PROVIDENCE 63996483 vi >>>>r > Chair Bart Pacekonis, Planning and Zoning Commission Members and Michele Lipe August 10, 2023 Page 2 The Connecticut Supreme Court has held that a zone change application, by its does not involve "conduct" that would cause pollution, and therefore § 22a-19 cannot be used to intervene in a zone change petition. A zone change is a mere reclassification of land. "Conduct" only occurs when an applicant seeks a permit the granting of which will allow some form of physical construction. That is not the case here. See e.g., Pond View, LLC V. Planning and Zoning Commission of Town of Monroe, 288 Conn. 143 (2008) (copy attached at Tab 1). This Pond View holding was reaffirmed in Douglas v. Planning and Zoning Commission of Town of Watertown, 127 Conn. App. 87 (2011) (copy attached at Tab 1). At pages 158-160, the Court held that a zone enange is a procedural issue, and therefore not "conduct" covered by §22a-19. Thus, the § 22a-19 interventions are invalid, because they are premature. Protest Petition General Statutes § 8-3(b) requires a protest petition to be signed by the owners of 20 percent of the land within 500 feet of the land proposed for rezoning. As shown on the attached analysis prepared by SLR Consulting and Metro Realty (Tab 2), there are 35.817 acres within 500 feet of the perimeter of the land proposed for rezoning. Twenty percent is 7.16 acres. Those who signed the petition (Tab 3) own only 5.56 of the 35.817 acres, which is 15.5 percent. The petition on its face is deficient. Commissioner Cavagnaro The standard for disqualification of a land use commissioner based on predetermination is that the commission has made one or more statements, orally or in writing, demonstrating that he/she had determined how to vote on the pending application prior to the public hearing. See R. Fuller, Connecticut Land Use Law and Practice § 47.2 (2011 and 2023 online update), citing Simko v. Ervin, 234 Conn. 498, 508 (1995). In addition, our courts have held that "The law does not require that members of zoning commission must have no opinion concerning the proper development of their communities. It would be strange, indeed, if this were true," citing Ciojfoletti v. Planning and Zoning Comm., 209 Conn. 544, 555 (1989). Here, the petition seeking disqualification is based solely on Commission Cavagnaro's membership in a statewide organization that advocates for affordable housing, not any statement he has made before the current public hearing, predicting or indicating how he would vote on Metro Realty's application. Thus, the petition lacks the very type of evidence that our courts have held is necessary to show disqualifying predetermination. AL8ANY EOSTON CHICAGO HARTFORD 63996483 vi >>>>>MANCHESTER NEW YORK PRQVIDENCE>> Chair Bart Pacekonis, Planning and Zoning Commission Members and Michele Lipe August 10, 2023 Page 3 The three petitions must be denied. Thald< you for your attention. Very truly yours, Timothy S. Hollister TSH:afz Enclosure cc:Attorney John Parks Metro Realty SLR Consulting >ALBANY > BOSTON > CHICAGO > HARTFORD MANCHESTER > NEW YORK PROVIDENCE 63996483 vl >> Tab Pond View, LLC v. Planning and Zoning Com'n of Town of Monroe, 288 Conn. 143 {2008) 953 A.2d 1 '`,,'''. KeyCite Yellow Flag - Negative Treatment Distinguished by Diamond 67. LLC y. Planning and Zoning C`om'nofTown of Vemon, Conn.App,. April 5. 201 l West Headnmes (12) [1]Zoning and Planning 4-Right of review and 288 Conn. 143 Supreme Coult of Connecticut. POND VIEW, LLC v. PLANNING AND ZONING COMMISSION OF the TOWN OF MONROE et al. ND. 17878. I Argued April 23, 2008. I Decided July 29. 2008. parties Town planning and zoning commission did not join in environmental illtervenofs' petition for certification to appeal from the trial court's judgment or file its own petition tor certification, although it tiled an appellate brief and participated in oral argument before the Supreme Court in support of the position of the intexvenors, and thus commission was not an appellant in the appeal to the Supreme Court and the Supreme Court would not consider its contentions regarding the propriety of the trial court's judgment , 2 Cases that cite this headnote I2]Zoning and Planning +-Further Review Synopsis Background: Landowner appealed from town planning and zoning commission which denied landowner's application for a zone change and special exception permit for its property in order to develop shopping center. The Superior Court, Judicial District of Fairfield, Howard T. Owens, 111, Judge Trial Referee, sustained in part and remanded. Environmental interveners who had filed petition in protest with the commission filed petition for certification to appeal. The Appellate Court granted certification, and the Supreme Court transferred the appeal. While zoning appeals from the Superior Court may proceed only upon a grant ofcextification by the Appellate Court, they are subject to the same jurisdictional prerequisites as other appeals from the Superior Court. C.G.S.A. § 52-263. [3]Action Persons entitled to sue Holdings: The Supreme Court, At, J,, held that: If a party is found to lack standing, the court is without subject matter jurisdiction to determine the cause. [1] challenged procedural issues were not within scope of statute;6 Cases that cite this headnote [2] zoning changes did not result in any environmental hand as required br standing, and [4]Determination of questions of jurisdiction in general A determination regarding a trial coull's subject matter jurisdiction is a question of law. Courts [3] protest petition did not confer statutory standing on intewenors. 8 Cases that cite this headnote Appeal dismissed. [5]Appeal and Error 9'Plenary, free, or Procedural Posfure(s): On Appeal.independent review When the trial court draws conclusions of law, review is plenary and the Supreme Court, must F WESTLAW Q ..4..,F:'}2 I~r»~l-»»~i r 1.¢>-.,.Q t;,-l?f";-r yv\t--_-J\4518 v Pond View, LLC v. Planning and Zoning Com'n of Town of Monroe, 288 Conn. 143 (2008) 953 A.2d 1 decide whether its conclusions are legally and logically correct and Lind support in the facts that appear in the record. standing as statutorily aggrieved parties Io appeal trial court's determination that commission's decision denying application tor a zone change was arbitrary and void. C.G.S.A. §22a-19. 5 Cases that cite this headnote 16 Cases that cite this headnote [6]Action @-Persons entitled to sue Two broad yet aggrievement exist classical and statutory. distinct categories of for standing purposes, 110]Zoning and Planning Right of review and 50 Cases that cite this headnote [7]Action 3- Persons entitled to sue parties Zoning changes did not result in any environmental harm to the "air. water or other natural resources of the state" as required tor environmental interveners to have standing as statutorily aggrieved persons to appeal merits of trial court decision that planning and zoning commission's decision denying application for a zone change in order to construct shopping center was arbitrary and void; alleged environmental banns all stemmed from proposed constriction under a site plan application and special exception permit, which were the suhiect of a separate appeal. C.G.S.A. §22a-19. Classical aggrievement requires a two part showing to demonstrate standing, first, a party must demonstrate a specific, personal and legal interest in the subject matter of the controversy, as opposed to a general interest that all members of the community share, and second, the party must also show that the alleged conduct has specially and injuriously affected that specific personal or legal interest. 26 Cases that cite this headnote 6 Cases that cite this headnote [8]Action *Persons entitled to sue [11]Zoning and Planning Right of review and Statutory aggrievement exists by legislative Hat, not by .judicial analysis of the particular facts of the case, in other words. in cases of statutory aggrievement, particular legislation grants standing to those who claim injury to an interest protected by that legislation. parties W 85 70 Cases that cite this headnote [9]Zoning and Planning 'p Right of review and parties Protest petition which environmental interveners filed with town planning and zoning commission did not confer statutory standing on interveners as aggrieved parties to pursue appeal of trial court's determination that comnlission's decision denying application for zoning change arbitrary and void, although filing of tile petition required commission to approve die application only by a supermajority, commission automatically denied the application because a supermajority had not voted br it, and trial court concluded in essence that a supennajority should have voted for it, none of those actions caused damage to any interest that interveners may have had to have a supemrajority approve the zone court's zoning change.C.G.S.A. § 8-3(b). Issue of whether trial court could review town planning and zoning connnission's decision to determine whether it was supported by substantial evidence despite environmental interveners'protest petition,along with trial treatment of stamte's supennajority and notice provisions, were procedural issues rather than environmental issues within scope of environmental intervenor statute, and thus interveners did not have 5 Cases that cite this headnote WESTLAW f~-»- F Pond View, LLC v. Planning and Zoning Com'n of Town of Monroe, 288 Conn. 143 (2008) 953 A,2d 1 [12]Zoning and Planning 41-Number of votes required The filing of a valid protest petition permits a planning and zoning commission to approve an application tor a zone change only by a supermajority.C.G.S.A. § 8-3(b)_ 2 Cases that cite this headnote Attorneys and Law Firms **2 Frank B. Cochran, New Haven, for the appellants (defendant Elizabeth Murphy el al.). The record resects the following undisputed fakzts and procedural history. The plaintiff owns a parcel of land in the town of Monroe (town), approximately one acre of which falls within a DB-2 business and commercial zone, and approximately seventeen acres of which *147 fall widiin a residential zone. The one acre within the business and commercial zone abuts Main Street, which is state highway Route 25, where many of the businesses in the town are clustered. On or about November 16, 2004, relative to a proposed retail development project to build a shopping center, the plaintiff filed a combined application with the commission br: (1) a design district zone change to designate the entire parcel as a DB-1 business and commercial zone, and (2) a special exception permit w*4 br approval of the site plan of its shopping center project, as required under the town's zoning regulations. 6 Christopher J. Smith, with whom was Beth Bryan Critton, Hartford, br the appellate (plaintiff). Frederick J. Malvin, town attorney, Monroe, for the appellate (named defendant). NORCOTT, KATZ, PALMER,VERTEFEUILLE and ZARELLA, JS. Opinion KATZ, J. 11] Lundy, Notice of the public hearing on the combined application, which was set to begin on December 1, 2004, was published on or about November 19, 2004. Prior to the start of the commission's hearing on the plaintiffs combined application. the interveners tiled a pleading to intervene in the proceedings pursuant to § 22a-19(a). The interveners' verified pleading alleged that: (1) the proposed site development plan for the shopping center would destroy forested steep hillside, (2) the proposed roads, loading docks and parking areas associated with the prqiect significantly would impact natural resources, including air, water and other resources, (3) the construction and operation of the project negatively would impact downstream wetland and watercourse resources, (4) the proposed large septic systems in the site plan would pollute downgradient water resources, and (5) the excavation and site work would produce major erosion, sedimentation and pollution *148 discharges into the air and water that are beyond the ability of an erosion control system to prevent. *145 The defendants Elizabeth Miuphy and Sally environmental interveners ww3 (interveners) 1 pursuant to General Statutes §22a-l9(a), 2 appeal, following the Appellate Court's grant of certification, lion the judgment of the trial court sustaining the appeal of the plaintiff, Pond View, LLC, from the decision of the *146 named defendant, the planning and zoning commission of the town of Monroe (commission), denying the plaintiffs application tor a zone .3 .change. On appeal to this court,the interveners contend, inter alia, that, when reviewing the commission's decision, the trial court failed to take into account the effect of a valid protest petition filed with the commission pursuant to On December 1 and 2, 2004, the commission held hearings 011 the combined application, at which time the plaintiff presented supporting expert evidence. The intenienors filed a petition in protest of the plaintiff's application pursuant Genera] Statutes 8-3(b). 4 The plaintiff responds that the iuterveuors lack standing to bring this appeal because they have failed to raise any environmental issues in accordance with § 22a-19(a).5 We agree with the plaintiff that the interveners lack standing, and, theretbre, we lack jurisdiction to consider their appeal. to § 8-3(b), which was signed by approximately tbrty individuals who owned property near the plaintiffs property. On March 3, 2005, the commission voted on the application. Susan Scholler. vice chainman of the commission, submitted a written motion setting forth specific reasons to deny the application tor a zone change, essentially contending that it represented too great a change from the existing zoning and would have too great an impact on a neighborhood that F WESTLAW F Pond View, LLC v. Planning and Zoning Com'n of Town of Monroe, 288 Conn. 143 (2008) 953 A.2d t the concerns raised by the surrounding landowners, while reasonable, were unsubstantiated. residents expected to be residential, not commercial. 7 Her motion was not seconded and thereibre failed. Commission member John Epifano then moved to grant the application br die zone change, which was seconded, and the commission thereaftei' voted three to two to grant the plaintiff's application for a zone change. Both Scholler's and Epifano's motions noted that the interveners had filed a protest petition in Specifically, the court concluded that the record supported the view that the zone change satisfied the requirelnents of accordance with § 8-3(b). Because § 8-3(b) requires a two-thirds vote to approve an application when it has been opposed by a valid protest petition, however, the commission deemed the three to two vote insufficient, and *149 accordingly "autontatically" denied **5 the plaintiffs application for failing to receive the tour requisite votes. As a result of its denial of the zone change application. the commission denied as moot the plaintiHls application for a special exception permit for approval of its site development plan. Harris v Z011i11g C`0mmissio11, 259 Conn. 402, 417, 788 A.2d 1239 (2002), in that it was; (1) in accordance with the town's comprehensive plan, and (*) reasonably related to Pursuant to General Statutes § 8-8, the plaintiff appealed dion the comlllission's decision to the Superior Court. The plaintiff served notice of its appeal on the interveners and stated in its complaint to the trial court: "[Murphy and Lundy]may, within their discretion, be [i]ntervenors to this appeal as provided by [§ ] 22a-l9...." The interveners filed an answer to the plaintitl's complaint in which they "aver[red] that they were properly named as defending parties because they circulated the protest [petition]" and raised a special defense that the "plaintiff has abandoned the plan to construct a shopping center in a residential zone." Thereafter, the interveners filed their brief on the merits of the appeal, but did not file a motion to be made parties, pursuant to General Statutes § 52-102(1)8 and Practice Book § 9-6. Prior to the commencement of oral argument 011 the merits off he appeal, the plaintiff iiled a motion to strike the interveners' brief on the ground that the inteivenors had raised issues that were outside of the scope of those permitted pursuant to §22a-19. the normal police power purposes enumerated in General Statutes § 8-2. For guidance in applying the town's comprehensive plan, the court looked to the town's zoning regulations and their requirements for commercial zones, and to the town's 2000 plan for conservation and development. The trial court noted that the town's plan for conservation and development revealed an intent to encourage incremental development of businesses and industry to expand tax revenue, particularly along *W6 Routes 25 and ll1, but that major expansions were disfavored, specifically because of limited access to highways and "lack of public water and/or sewers in certain areas." In concluding that the plaintiff had proiibred sufficient evidence in support of its application, the trial court relied on the following evidence. The town's *151 inland wetlands commission conditionally had approved the proposed development prior to the commission's decision, and the plaintiff had received favorable approval from other town officials and agencies. The plaintiff also had proffered reports, studies and testimony from experts in support of its application tor both the zone change and the site plan application that addressed and reported favorably on various concerns relative to the town's comprehensive plan and the impact 011 adiacenl property owners, including environmental concerns. Accordingly, the court concluded that the commission's decision denying the plaintiffs application for a zone change was arbitrary and void. Because the commission had not reached the merits of the plaintiffs application for the special exception permit regarding the site development plan, the court did not consider that issue and remanded tlle case to the commission to address that application. The trial court held hearings and therealier issued a memorandum of decision sustaining the plaintiffs appeal iron the denial of its application tor a zone 9150 change. 9 The trial court concluded that the record did not support the comnlission's decision to deny the plaintiffs application. The trial court determined, in light of the record, that Scholler's motion setting thanh specific reasons to deny the plaintiffs application, see footnote 7 of this opinion, "adequately represent[ed]" the commission's reasons for denying the application. The court concluded, however, that there was no evidence in the record to support these reasons and that In a footnote in its memorandum of decision, the trial court stated that it was denying the plaintiffs motion to strike the interveners' brief, noting that all but one of the issues raised by the interveners also had been raised by the commission. The only allegation raised solely by the interveners was a challenge to the commission's lack ofjurisdiction on the basis WESTLAW F F F F Pond View, LLC v. Planning and Zoning Com'n of Town of Monroe, 288 Conn. 143 (2008) 953 A,2d 1 of the plaintiil's thilure to file notice of the zone change ten days in advance of the hearing in violation of § 8- 3(a). The court stated that it nonetheless would consider the was improper.... Superior Court. In that appeal, the interveuors alleged that the decision of the commission to grant the special permit exception "arbitrary, illegal, without support and procedurally That appeal currently is pending before the § 8-3(a) argument "[t]or the sake of completeness" and because it implicated the commission's jurisdiction. The court rejected the interveners' contention regarding § 8-3(a) as meritless, however, because the statute refereed to calendar days and not business days, and therefore the tiling of the notice was timely. The trial court did not draw any conclusion as to whether the arguments raised by the interveners in their brief properly were within the scope of § 22a-19(a), nor did the *152 trial court address expressly how the interveners' protest petition Figured into its determinations. In the present appeal before this court, the imewenors raise five claims of impropriety by the trial court. The interveners first contend that the trial court failed to apply the correct standard of review for the denial of a zone change when Thereafter, the interveners tiled a motion for reargument with the trial court in which they contended that the trial court had failed to rule on a dispositive issue: whether "a decision a valid protest petition has been filed pursuant to § 8- 3(b). Second, the interveners contend that, contrary to the trial court's conclusion. the record of the administrative proceedings "overwllelmingly" supports the columission's decision to deny the plaintiH's application for a zone change. Third, they contend that the trial court failed to consider the effect of the protest petition on the commission's decision, and iburth, absent a finding that the protest petition was invalid. the court failed to sustain Me decision on that ground. Finally, the inteivenors contend that the plaintiff tailed to comply with to deny [a zone change application], required by § 8- 3(b), may nonetheless be invalidated as arbitrary, capricious or illegal." Over the plaiiitiffs objection. the court granted the interveners' motion and held oral argument, but subsequently reaffirmed its earlier decision. Following this decision by the court, the commission did not seek pemiission to appeal. The interveners, however, filed a petition for certification to appeal to the Appellate Court pursuant to General Statutes § 8-9, which the plaintiH` opposed on the ground that the interveners did not have standing. The Appellate Court ultimately granted the interveners' petition tor certification. the requirements of § 8-3(a) because it did not file "the precise boundaries of the area proposed tor a change" with the town clerk's otlice ten business days before the hearing on the application. While the interveners' petition tht certification was pending, the following additional events occurred relevant to this case. [2]The plaintiff responds that the interveners lack standing to bring this appeal because they have tailed to raise any of the environmental issues within the scope off 22a-19 and because they never made a motion to be made parties. In the event that this court determines *154 that the interveners do have standing, the plaintiH` contends that the trial court reviewed its claim under the appropriate standard of review and properly determined that the conlmission's decision was arbitrary and capricious. We conclude that the interveners lack standing. 11 I After the trial court's decision approving the zone change, the conunission, on or about September 21, 2006, voted tour to one to approve the plaiutiifs application for a special exception permit, which would allow the plaintiff to build the shopping center in accordance with its site plan. On or about December 5, 2006, the interveners w*7 filed an appeal from that decision to the Superior Court. In that appeal, the intervenor, along with two other individuals, JetTrey Zimnoch and Hannah Zimnoch, alleged in their complaint that Murphy, Jeffrey Zimnoch and Hannah Zininoch were stamtorily aggrieved pursuant to General Statutes § 8-8(a) because they owned property within 100 feet of the plaintilTs property, and that Lundy was "classically aggrieved by being subjected to dust, noise,*153 potential loss of her " 10 They also alleged standingwell and other 1111isances.,.. under General Statutes §§ 8-3(b). 22a-16 and 22a-l9(a). We begin with the plaintiffs contention that this court lacks subject matterjurisdiction w*8 because the iutervenors have raised only procedural issues and therefore do not have standing to bring this appeal as environmental imervenors pursuant to § 22a-19. Specifically, the plaintiff contends that the zone change itself does not involve "conduct" that may be analyzed for its unreasonable pollution eHlects on the air, water or other natural resources. Rather. it is the plaintiffs site specific development proposal presented via F WESTLAW F F F F F F Pond View, LLC v. Planning and Zoning Com'n of Town of Monroe, 288 Conn. 143 (2008) 953 A.2d 1 of the [controversy], as opposed to 8 general interest that all members of the community share.... Second, the party must also show that the [alleged conduct] has specially and injuriously affected that specific personal or legal interest... its application for a special exception pen lit that involves the actual conduct that ultimately and allegedly could have unreasonable environmental effects. Thus, it contends that the proper form for these § 22a-19 interveners is the proceeding relating to the comnlission's later grant of the special exception permit, the appeal from which currently is pending before the Superior Court. The interveners *155 respond that they have standing to bring their claims under § 22a-19 because concerns related to the preservation of natural resources underlying the town's plan of conservation and development provided a basis for the commission's denial of the proposed zone change and thus bring the issues in this appeal within the scope of that statute. We agree with the plaintiff [8]"Statutory aggrievement exists by legislative fiat, not by judicial analysis of the particular facts of the case. In other words, in cases of statutory aggrievement, particular legislation grants standing to those who claim injury to an interest protected by that legislation." (Internal quotation marks omitted.) Andmss v West **9 Hartford, 285 Conn. 309, 321-22, 939 A.2d 1146 (2008). [3]141 regarding 151 standing "We begin with some well settled principles and its aggrievement component, as recently reaifinued in Windels V. Enviromnental Plvteerion Commission, 284 Conn. 268, 287-89. 933 A.2d 256 (2007). If a party is found to lack standing, the court is without subject umatter jurisdiction to determine the cause.... A determination regarding a trial court's subject matter jurisdiction is a question of law. When the trial court draws conclusions of law, our review is plenary and we must decide whether its conclusions are legally and logically correct and find support in the facts that appear 'm the record.... The statute that the interveners in the present case claim grants them standing, §22a-l9(a), provides: "In any administrative, licensing or other proceeding, and in any judicial review thereof made available by law. the Attorney General. any political subdivision of the state, any instrumentality or agency of the state or of a political subdivision thereof, any person, partnership, corporation, association, organization or oder legal entity may intervene as a party on the tiling of a verified pleading asserting that the proceeding or action for judicial review involves conduct which has, or which is reasonably likely to have, the effect of unreasonably polluting, impairing or destroying the public trust iii the air, water or other natural resources of the state." added.) (Emphasis and subsequent On the basis of this expansive language, we previously have concluded that § 22a-19 confers standing on a broad range of individuals, entities and government *157 agencies to intervene in both administrative proceedings "judicial review" thereof 011 appea1.12 "Standing is not a technical rule intended to keep aggrieved parties out of court; nor is it a test of substantive rights. Rather it is a practical concept designed to ensure that courts and parties are not vexed by suits brought to vindicate noniusticiable interests and that judicial decisions which may affect the rights of others are lbrged in hot controversy, with each view fairly and vigorously represented.. These two objectives are ordinarily held to have been met when a complainant makes a colorable claim of direct injury he has suffered or is likely to suffer, in an individual or representative capacity. Such a personal stake in the outcome of the controversy provides the requisite assurance of concrete adverseness and diligent advocacy.... The requirement of directness between the injuries claimed by the plaintiff and the conduct of the defendant also is expressed. in our standing jurisprudence, by the focus *156 on whether the plaintiff is the proper party to assert the claim at issue.... Ava/onBa_1' C`omn111nilies, Inc. x: Zoning C`ommission, 280 [6][7]"Two broad yet distinct categories ofaggrievement exist, classical and statutory.... Classical aggrievement requires a two pan showing. First, a party must demonstrate a specific, personal and legal interest in the subject matter Conn. 405, 413-14, 908 A.2d 1033 (2006),Red Hill Coalition M Town Plan & Zoning Commission, 212 Conn. 727, 733-34, 563 A.2d 1347 (1989). We also consistently have acknowledged, however, that an intervenor's standing pursuant to § 22a-19 strictly is limited to challenging only environmental issues covered by the statute and "only those environmental concerns that are within the jurisdiction of the particular administrative agency conducting the proceeding into which the party seeks to intervene." lit Nizzardo \1 Stare Tragic Commission, 259 Conn. 131, 148, 788 A.2d 1158 (2002), accord Rocque it Northeast Utilities Service Co., 254 Conn. 78, 85, 755 A.2d 196 (2000) (intervention under § 22a-19 "strictly limited to the raising of environmental WESTLAW F Pond View, LLC v. Planning and Zoning Com'n of Town of Monroe, 288 Conn. 143 (2008) 953 A.2d 1 issues" [internal quotation marks omitted] ),M1'srie Marine/lfe Aquarium, Inc. VI Gill, 175 Conn. 483, 490, 499- 500, 400 A.2d 726 (1978) (concluding that intervenor that has filed verified pleading at administrative level pursuant to § 22a-19 has standing to appeal on basis of that pleading "limited to environmental issues on1y"),Be/ford u New Haven, 170 Conn. 46, 54, 364 A.2d 194 (1975) ( "{t]he [Enviromnental Protection Act of 1971, General Statutes § 22a-14 et seq.] does *158 not confer standing upon individuals to challenge legislative decisions of a municipality which do not directly threaten the public trust in the air, water and other natural resources of this state"). [9]In the present case, there can be little doubt that the interveners are persons who legally may intervene in an administrative proceeding and appeal therefrom under §22a- 19(a), for the statute grants that power to "any" individual. **10 Nor is there any debate that the interveners properly tiled a pleading with the commission containing the requisite specific allegations that the proposed site development plan would cause certain adverse enviromnental impacts 011 the "air' water or other natural resources...."Red Hill C`oalitio11, Ine. H Town Plan & Zoning Commission, supra, 212 Conn. at 733-34, 563 A.2d 1347 (§ 22a-19[a] grants individuals standing to intervene before planning and zoning commissions as matter of right, "once a verified pleading is filed complying with the statute, whether or not those allegations ultimately prove to be ullfounded"). The sole question then is whether the issues that the interveners ask us to decide in the present appeal are those properly within the scope of the statute. r' *159 It is clear that these issues are not environmental issues traditionally within the scope of § 22a-19. The issues related to §8-3 raise questions of construction ofa zoning stamte of general application, and the issue of the standard of review is one of appellate procedure in an administrative appeal. The interveners have cited no case, and we have found none, in which this court has permitted environmental interveners to raise purely procedural issues when the only basis for standing that they have alleged is § 22a-19. Although this court never expressly llas concluded that standing under § 22a-19 does not include standing to raise any related procedural issues, it is axiomatic that the statute encompasses substantive environmental issues only, and the court repeatedly has declined to consider whether procedural issues are covered. 13 See, e.g., Roeque u Northeast Ufililies Service Co., supra, 254 Conn. at 80, 85-86, 755 A.2d 196 (stating first that § 22a-19 is limited to environmental issues, and declining to decide question of whether fraud and collusion in settlement between state and nuclear power plant over dumping of contaminated wastewater from plant constituted environmental issue because claim was meritless), F'Galdiner u C`onservario11 C`ommission, 222 Conn. 98, 106-107, 608 A.2d 672 (1992) (declining to consider abstract claim that § 22a-19 permits standing to raise nonenviromnental claims that bear "inextricable nexus" to environmental issues). 14 The **11 cases wherein we have permitted standing *160 under §22a-19 have involved circumstances in which the couducl at issue in the application before this court allegedly would cause direct hann to the Although they have raised five claims in their brief, the primary issues that emerge on appeal concern the trial coult's standard of review, its treatment of the supermajority provision in § 8-3(b), and its construction of the env1ronnle11t. See, et.,Red Hill ("0a/irion, Inc. v Town Plan & Zoning (`0rnlnission, supra, 212 Conn. at 730- 33, 563 A.2d 1347 (intervention pursuant to § 22a-19 on ground that proposed development of land "would result in the irreversible elimination of major portions of prime agricultural land" was proper but agricultural land ultimately determined not "natural resource" within meaning of statute notice provision in § 8-3(a). Specifically, the interveners challenge the trial court's determination that it could review the commission's decision to determine whether the decision was supported by substantial evidence, despite their protest petition, which the court did not conclude was invalid. They submit that the proper standard of review is that "denial of a proposal to change the zone of property could be considered arbitrary only if it was counter to law or unsupported by any of the applicable statutory principles of zoning." [internal quotation marks omitted] ),M.1'sfic Marinelife Aqz/arium, Inc. in Gill, supra, 175 Conn. at 485, 490, 400 A.2d 726 (appeal from approval of permit to construct floating dock and other structures along river that would harm environment), see also Fort Trumbull C`o11se1'va11c;; LLC u New London, 282 Conn, 791, 805-808, 925 A.2d 292 (2007) (concluding [l] that development plan itself constituted conduct that could cause harm to environment within the meaning of § 22a-16, and 121 that allegation of violation of"technical or procedural requirements" does not WESTLAW F F F Pond View, LLC v. Planning and Zoning Com'n of Town of Monroe, 288 Conn. 143 (2008) 953 A.2d 1 give rise to claim of unreasonable pollution for purposes of standing under §22a-16). of a valid protest petition permits a planning and zoning commission to *162 approve an application tor a zone change only by a supel'nlajority. Thus, the only interest of the interveners that the statute protected was their right to force a supemlajority vote on the zone change. See f"Blaker 1' Plamling& Zoning Commission, 212 Conn. 471, 475-76, 562 A.2d 1093 (1989) (reviewing plaintiffs appeal from zoning conlmission's decision granting applicant's zone change on basis that commission approved zoning application by less i" [10]To the extent that the interveners challenge the merits of the trial court's decision-i.e., the propriety of its determination that all of the evidence supported the plaintiffs position that the development resulting from the proposed zone change would be consistent with the town's comprehensive development plan-that challenge relates to the special exception permit application that is the subject of the appeal currently pending before the Superior Court. In other words, any environmental harm to the "air. water or other natural *161 resources of the state" necessarily would result from the plainti13's conduct in actually developing the property, not from the zone change at issue in this appeal. Indeed, it is evident from the allegations in the interveners' complaint that the alleged environmental banns all stem from the site plan application for the construction of the shopping center. TherefOre, to the extent that the interveners want to challenge the environmental impacts of the construction of the shopping center and related procedural issues that are within the conlmission's jurisdiction to consider_ the proper form for such challenges is their appeal train the commission's decision granting the plaintiffs special exception permit or, more specifically, approving the site plan. It is this application that actually involves the "conduct" by the plaintiiil-i.e., the construction of a shopping center -that might lead to adverse environmental impacts that standing pursuant to §22a-19 is meant to guard against. than supermajority despite plaintilT's § 8-3[b] protest petition), on appeal after remand, 219 Conn. 139, 592 A.2d ISS (1991). In the present case, the commission complied H 1111 The interveners also claim to have standing by virtue with the provisions of § 8-3(b) when if automatically denied the application because a supermajority had not voted in &vor of it. The trial court, however. concluded that the decision of some members to deny the application was not supported by substantial evidence. and therefore, in essence, determined that a supennajority should have voted to gant the application. None of these actions caused damage to any interest that the intervenor may have had under the statute to have a supermaiority approve the zone change, and thus they are not aggrieved. 15 See AvalonBav Colnllzunities, Inc. u Orange, 256 Conn. 557, 568, 775 A.2d 284 (2001) ("The fUndamental test for determining aggrieveinent encompasses a well-settled twofold determination: first, the party claiming aggrievement must successlillly demonstrate a specific, personal and legal interest in [the subject matter of the challenged action], as distinguished tiom a general interest, such as is the concern ofall members of the *163 conununity as a whole. Second, the party claiming aggrievement must successfully establish that this specific personal and legal interest has been specially and iziiuriously affected by the [challenged action]." [Internal quotation marks omitted] ). 16 of having filed the protest petition in accordance with §8- 3(b), which, they contend, created a personal and legal interest in, and made them "indispensable" parties to, the present action. We disagree. Because the interveners have not alleged and proved any basis other than § 22a-19(a) Igor standing in this action, we are without jurisdiction to hear their appeal.w*13 Accordingly, we do not reach the merits of their claims. The appeal is dismissed. In this opinion the other justices concurred. 112]That statute provides in relevant part: "If a protest against a proposed change is filed at or before a hearing with the zoning commission, signed by the owners of twenty percent or more of the area **12 of the lots included in such proposed change or of the lots within five hundred feet in all directions of the property included in the proposed change, such change shall not be adopted except by a vote of two-All Citations asthirds of all the members of the commission..General Statutes § 8-3(b). As the text clearly indicates, the filing 288 Conn. 143, 953 A.2d I WESTLAW F F F Pond View, LLC v. Planning and Zoning Com'n of Town of Monroe, 288 Conn. 143 (2008) 953 A,2d 1 Footnotes 1 Although we refer to Murphy and Lundy jointly as the intewenors, where necessary, we refer to them individually by name. 2 General Statutes § 223-19(3) provides; "In any administrative, licensing or other proceeding, and in any judicial review thereof made available by law, the Attorney General, any political subdivision of the state, any instrumentality or agency of the state or of a political subdivision thereof, any person, partnership, corporation, association, organization or other legal entity may intervene as a party on the filing of a verified pleading asserting that the proceeding or action for judicial review involves conduct which has, or which is reasonably likely to have, the effect of unreasonably polluting, impairing or destroying the public trust in the air, water or other natural resources of the state." 3 We transferred the appeal from the Appellate Court to this court pursuant to and Practice Book § 65-1 . General Statutes§51-199(c) 4 General Statutes § 8-3(b) provides; "Such [zoning] regulations and boundaries [for zoning districts] shall be established, changed or repeated only by a majority vote of all the members of the zoning commission, except as otherwise provided in this chapter. In making its decision the commission shall take into consideration the plan of conservation and development, prepared pursuant to section 8-23, and shall state on the record its findings on consistency of the proposed establishment, change or repeal of such regulations and boundaries with such plan. If a protest against a proposed change is filed at or before a hearing with the zoning commission, signed by the owners of twenty per cent or more of the area of the lots included in such proposed change or of the lots within five hundred feet in all directions of the property included in the proposed change, such change shall not be adopted except by a vote of two-thirds of all the members of the commission." 5 The commission filed an appellate brief and participated in oral argument before this court in support of the position of the interveners. Because, however, it did not join in the interveners' petition for certification to appeal from the trial courfsjudgment or file its own petition for certification, the commission is not an appellant in the appeal to this court and we do not consider its contentions regarding the propriety of the trial courts judgment herein. 6 Section 117-1100 of the Monroe zoning regulations provides in relevant part: "A DB [Design Business] District shall be established and/or a DB use shall be permitted only in an area where the uses meet the conditions for a special exception permit, as provided in Sections 117-1801 and 117-1802.... Any new building to be constructed or any building not formerly a business shall be required to obtain a special exception permit for business use prior to its use. in addition the use will: "(1) Have no significant detrimental impact on the environment...," 7 The specific reasons listed in Schoiler's motion were: (1) the proposal is inconsistent with the plan for conservation and development, (2) the evidence and the testimony presented by the plaintiff do not make a case for rezoning according to General Statutes § 8-2, and (3) the plaintiff Nad not made a case for rezoning in right of the impacts on the adjoining properties; (4) "the existing character of the and - -and the degree of development impact to the area is inappropriate for a project of this magnitude", (5) WESTtlhe "establishment of a commercial zone would degrade the values of adjoining residential properties, (6) F Pond View, LLC v. Planning and Zoning Com'n of Town of Monroe, 288 Conn, 143 (2008) 953 A.2d 1 questions exist regarding the public health and welfare, particularly in the areas of water supply, sewage disposal, traffic management, and levels of activity to adjoining properties, and (7) questions remain as to the impact on outlying local roads 8 General Statutes §52-102 provides: "Upon motion made by any party or nonparty to a civil action, the person named in the party's motion or the nonparty so moving, as the case may be, (1) may be made a party by the court if that person has or claims an interest in the controversy, or any part thereof, adverse to the plaintiff, or (2) shall be made a party by the court if that person is necessary for a complete determination or settlement of any question involved therein, provided no person who is immune from liability shall be made a defendant in tlwe controversy." 9 We note that the interveners filed a certification with the Appellate Court indicating that transcripts of the proceedings before the trial court were npt necessary to the resolution of their appeal because the plaintiffs aggrievement was not at issue. Thus, the transcripts of the proceedings before the trial court are not part of the record in this appeal. 10 Although the interveners' complaint in the other appeal now pending before the Superior Court avers that Murphy lives within 100 feet of the plaintiffs land, the interveners have made no similar allegation in this appeal, and have not invoked standing under §8-8, 11 Because we conclude that the interveners tack standing to bring this appeal, we need not determine w Nether the trial court's ruling as to the zone change constitutes a final judgment on the "combined application" in light of the fact that the commission had not yet determined whether to grant the other portion of the application, namely, the special exception permit. See State V. Salmon, 250 Conn. 147, 162-63, 735 A.2d 333 (1999) (adopting "bright-line test requiring the appellant, in order to establish a right of appellate review pursuant to [General Statutes] § 52-263, to establish in the following sequence that: [1] it was a party to the underlying action, [2] it was aggrieved by the trial court decision, and [3] the appeal is from a final judgment"). While zoning appeals from the Superior Court may proceed only upon a grant of certification by the Appellate Court, they are subject to the same jurisdictional prerequisites as § 52-263 appeals. See Commission, 232 Conn. 122, 129-30 and n. 7, 653 A.2d 798 (1995). Kaufman V. Zoning 12 We previously have concluded that § 223-19(3) does not create "the right to appeal from administrative matters that are not otherwise appealable."Fort Trumbull Conservancy, LLC V. Planning & Zoning Commission, 266 Conn, 338, 361, 832 A.2d 611 (2003). In this regard, we note that §§8-8 and 8-9 create the avenues for appeal to the Superior Court and Appellate Court respectively in the present case. Section 22a-19 governs the scope of issues that environmental interveners have standing to raise when availing themselves of such avenues of appeal.ld., at 360-61, 832 A.2d 611, see also Branhaven Plaza, LLC V. Inland Wetlands Commission, 251 Conn. 269, 273-76 and n. 9, 740 A.2d 847 (1999) (certification to appeal pursuant to §8-8 to raise issues within scope of §22849 [8] );Mystic A/Iarinelife Aquarium, Inc. V. Gill, 175 Conn. 483, 490, 400 A.2d 726 (1978) (having become proper party in administrative proceeding, intervenor had statutory standing to appeal for limited purpose of raising environmental issues). 13 The plaintiff relies on Connecticut Coalition Against Millstone V. Connecticut Siting Council, 286 Conn, 57, 83-85, 942 A.2d 345 (2008), wherein we dismissed as moot one intervenor's claim that he was aggrieved under the Uniform Administrative Procedure Act, General Statutes §4-166 et seq., to raise a claim that two sitting council members had acted unethically because the trial court Nad dismissed that ethics claim on the merits after finding aggrievement under § 22a-19. We did not, however, review the trial courts conclusions WESTLAW F F F F Pond View, LLC v. Planning and Zoning Corn'n of Town of Monroe, 288 Conn. 143 (2908) 953 A.2d 1 concerning aggrievement under § 223-19 and, therefore, Nat case is not helpful to either the plaintiff or the interveners. 14 Even if we were inclined to consider procedural issues that bear a nexus to substantive environmental concerns covered by § 223-19, such as those related to § 8-3(3) and (b) in the present case, it is clear to us that no significant nexus exists between those issues and the environmental claims pleaded in the interveners' verified complaint. Moreover, we fail to see how any of the procedural issues that the interveners raise in the present case have prevented them from raising the environmental claims that they are permitted to raise under § 22a-19. 15 Indeed, if we were to conclude that § 8-3(b) afforded standing to appeal under these circumstances, such a construction would undermine § 8-8(a)(1), which authorizes aggrieved persons to appeal and which defines an "aggrieved person" as a person living within "one hundred feet of any portion of the land involved in the decision of the board." Because a § 8-3(b) petition may be signed by persons owning property within five hundred feet of a proposed change, the plaintiff's proposed construction would permit property owners that do not satisfy statutory aggrievement under § 8-8, which is intended to govern all zoning appeals, to appeal nonetheless. t6 We disagree with any contention by the interveners that they were named in the plaintiffs complaint to the trial court as necessary defendants or as anything other than §22a-t9 interveners. In addition, as we already have indicated, the environmental issues related to the special exception permit application were the only legal interests at stake for the interveners in the appeal from the commission's decision. As the previous discussion herein should make clear, that interest is not sufficiently implicated in the present appeal. See also Fox v. Zoning Board of Appeals, 84 Conn.App. 628, 637, 854 A.2d 806 (2004) ("[i]t is well established that [m]ere status as a party or a participant in the proceedings below does not in and of itself constitute aggrievement for the purposes of appellate review" [internet quotation marks omitted] ). End of Document ©2023 Thomson Reuters. No claim to original U.S. Government Works. WESTLAW F F F Douglas v. Planning and Zoning Com'n of Town of Watermwn, 127 Conn.App. 87 (2011) §A*.3'd`6g'§ , .-W Manu,..,,.., KeyCite Yellow Flag - Negative Treatment Distinguished by Greenwood Manor. LLC v, Planning and Zoning Com'n of City of Bndgeport, C`om1.App,,May 77, 2014 If a poNy is bund to lack standing, the court is without subject natter jurisdiction to determine the cause. 1 Case that cites this headnote 127 Conn.App. 87 Appellate Court of Connecticut.[2]Appeal and Error Suhiect-nnatta jurisdiction * Sebastian DOUGLAS et al. v. PLANNING AND ZONING COMMISSION OF the TOWN OF WATERTOWN. Detelmination of questions of jurisdiction in general A deteimination regarding a trial court's subject matterjurisdiction is a question of law, and when the trial court draws conclusions of law, the Appellate Court's review is plenary and it must decide whether its conclusions are legally and logically correct and Lind support in the facts that appear in the record. Courts ' No. 3 1626 I Argued Oct. 19. 2010. I Decided March 8, 201 I. 1 Case that cites this headnote [3]Courts Jurisdiction of Cause of ActionA. Synopsis Background: Landowners appealed decision of town's zoning commission upholding zoning ordinance amendment that created a zone permitting retail and office development in an existing industrial zone. The Superior Court, Judicial District of Waterbury, Brunetti, J., dismissed landowners for lack of standing. Landowners appealed. Subject matterjurisdiction involves the authority of the court to adjudicate the type of controversy presented by the action before it. 1 Case that cites this h¢=:adnQte Holdings: The Appellate Court, Flynn, J., held that:l4]Acts and proceedings without jurisdiction A court lacks discretion to consider the merits of a case over which it is without jurisdiction. Courts v= [1] owner of property that abutted or was within a radius of 100 feet of any portion of the zone was a statutorily "aggrieved person" with standing to challenge the amendment, and 1 Case that cites this headnote [2] owners of property from other parts of town did not have standing under environmental protection statute to challenge the amendment. [5]Courts AHinned in part, and reversed in part, with directions. Time of making objection Courts Determination of questions of jurisdiction in general The objection of want of jurisdiction may be made at any time and the court or tribunal may act on its own motion, and should do so when the lack ofjurisdictioxi is called to its attention.Procedural Posture(s): On Appeal, Motion to Dismiss. West Headnotes (14) [6]Courts Courts Waiver of Obj ections Time of making objection [1]Action 4° Persons entitled to sue WESTLAW 2023 T}"»L~t11$~€1 s No \'la=m to mununal U S GQvernmF-M We 9. Douglas v. Planning and Zoning Com'n of Town of Watertown, 127 Conn.App. 87 (2011) 13 A,3d 669 7he requirement of suhiect matter jurisdiction cannot be waived by any party and can be raised at any stage of the proceedings. Neither prong of twofold test for proving classical aggrievemeut br standing purposes must be shown by person allegedly aggrieved by a decision of a zoning board if the plaintiff is statutorily aggrieved. C.G.S.A. §8-8(a)(l). [71 Action Persons entitled to sue*6 Cases that cite this headnote £111 Zoning and Planning 4-Mnditicalion or "Standing" is not a technical rule intended to keep aggrieved parties out of court, nor is it a test of substantive rights, rather it is a practical concept designed to ensure that courts and parties are not vexed by suits brought to vindicate noniusticiable interests and that judicial decisions which may affect the rights of others are forged in hot controversy, with each view fairly and vigorously represented. amendment ) Case that cites this headnote [8]Zoning and Planning ~:»-Modification or amendment Even if landowner was able to opt out of the text amendment to the zoning map permitting commercial uses in area of the municipality, which, prior to the amendment, allowed only industrial uses, owner was a statutorily "aggrieved party" with standing to challenge amendment to regulations, where owner's property abutted or was within a radius of 100 feet of any portion of defined. bounded zoning district to which text amendment pertained. C.G.S.A. §8-8(8)(1). 4 Cases that cite this headnote Text amendment to zoning regulation, which created a zone pemlitting retail and office development in an existing industrial zone, sufficiently defined the specific,limited geographic area to which the text ainendnient related, and, therefbre, the new zoning district could not be considered a floating zone for standing purposes. 1121 Environmental Law 0-Other particular 4 Cases that cite this headnote [9]Action 9-Persons entitled to sue parties An intervenor's standing pursuant to environmental protection statute allowing a person to intervene as a party to challenge administrative decision which is likely to cause unreasonable pollution is limited to challenging only environmental issues covered by the statute, and only those environmental concerns that are within the jurisdiction of the particular administrative agency conducting the proceeding into which the party seeks to intervene. C.G.S.A. §22a-19. 4 Cases that cite this headnote Classical aggrievement for standing purposes encompasses twofold showing: first, party claiming aggrievement must successfully demonstrate specific personal and legal interest in subject matter of decision, as distinguished from general interest, such as is the concern of all community members as a whole, and second, party must successiillly establish that the specific personal and legal interest has been specially and injuriously adected by the decision. 113]Environmental Law '(')they particular 4 Cases that cite this headuote [10]Zoning and Planning 'iv Right of Review; Standing parties Allegations of noncompliance with procedural requirements when zoning commission proceeded to add text amendment to zoning regulation permitting commercial uses in area of the municipality, which, prior to the amendment, allowed only industrial uses, did not give rise WESTLAW Douglas v. P\arming and Zoning Com'n of Town of Watertown, 127 Conn.App. 87 (2011) 13 A,3d 669 to standing to challenge the commission's action pursuant to environmental protection statute allowing a person to intervene as a patty to challenge adnNnistrative decision which is likely to cause unreasonable pollution. C.G.S.A. §22a- l9(a). regulations (text. amendment) to create a B-PCD262 zone permitting retail and office development in an existing industrial zone. The text amendment created what the trial 3 Cases that cite this headnoie £141 Environmental Law Other particular parties Zoning and Planning iv' Modification or amendment 0' Inclusion of environmental issues in the complaint by owners of land outside of affected zoning area did not per se provide owners with standing under environmental protection statute to challenge zoning commission's text amendment to zoning regulation permitting commercial uses in area of the municipality, which, prior to the amendment, allowed only industrial uses, zoning change was a legislative action which did not directly threaten the environment. C.G.S.A. §22a-19. I Case that cites this headnote court termed an "overlay zone," which. under specific circumstances and subject to specific preconditions detailed in the text amendment, affected the land bounded by Route 262, Turkey Brook, Echo Lake Road. Connecticut Route 8, and Frost Bridge Road, in Watertown. Andrew (landed plaintiff) appeals as an owner of land located within the newly created zoning district pursuant to General Statutes § 8-8(a)(l),1 and the other seven plaintiffs (intervening plaintiffs) eachiiled verified petitions *90 to intervene in the administrative proceedings before the commission pursuant to General Statutes § 22a-I 9 (a). On appeal to this court. the landed plaintiff contends that the trial court erred in holding diet he did not have standing to challenge the adoption of the text amendment establishing the new zoning district. The intervening plaintiffs contend. inter alia, that the trial court erred in holding that they did not have standing to appeal to the Superior Court from the decision of the commission adopting the new zoning district. We conclude that the trial court improperly dismissed the landed plaint'ifTs c8se and reverse the judgment in part with direction to restore the landed plaintiffs case to the docket. As to the intervening plaintiffs, we affirm the judgment of the trial court dismissing their intervening complaint. Attorneys and Law Firms w*670 Malorie Shansky. New Haven, for the appellants (plaintiffs) Dov Braunstein. with whom, on the brief, was Paul R. Jessell_ Watertown, tor the appellate (defendant). kk671 DiPENTIMA. c.J.. and LAVINE and FLYNN, Js. Opinion FIYNN, J. The allowing ihcls are relevant to our analysis. The landed plaintiff owns land that abuts Of' is within a radius of 100 feet of the new zoning district. and the intervening plaintiffs own land elsewhere in the town of Watertown. The conunission proposed a text amendment to article III -business districts of the Watertown zoning regulations to add a new Section 36 entitled "Draft November 8, 2008. Route 262 Planned Commercial District (B-PCD262)" See Watertown Zoning Regs., § 36. The text amendment added to the previously permitted industrial uses certain commercial uses for the development of"l1igh quality retail and office development."2 Section 36.2 of the Watertown *k672 zoning regulations provides in relevant part that boundaries of the overlay District are Route 262. Turkev Brook. Echo Lake Road. Route 8. and Frost Bridge Road," consisting of only approximately 150 acres. 3 Alter hearings, the commission enacted the text amendment oil November 10, 2008, and published notice on November 13, 2008, in the newspaper. "[t]he outexmosl *91 *89 the plaUltlfl' Jonathan Andrew and the intervening plaintiffs,Sebastian Douglas. Gloria Lynn, Elizabeth Wasiutynski, Bohdan Wasiutynsld. Angela Maggi, Judith M. Wick and Glenn LaFneniere. appeal from the judgment of the trial court dismissing their challenge to the defendant Watertown planning and zoning colmnission's (commission) adoption of a text amendment to the Watertown zoning The intervening plaintiff and the landed plaintiff tiled the original action. by verified complaint, on Januaiy _ 2009. WESTLAW Douglas v. Planning and Zoning Com'n of Town of Watertown, 127 Conn.App. 87 (2011) 13 A.3d 669 represented.... These two objectives are ordinarily held to have been met when a complainant makes a colorable claim of direct injury he has sutiered or is likely to suffer. in an individual or representative capacity. Such a personal stake in the outcome of the controversy provides tlle requisite assurance of concrete adverseness and diligent advocacy... The requirement of directness between the injuries claimed by the plaintiff and the conduct of the defendant also is expressed, in our standing jurisprudence, by the focus on whether the plaintiffs the proper party to assert the claim at issue." (Citations omitted, internal quotation marks omitted.) For/ Tnimbull Conservancy LLC v Alves 262 Conn. 480 485-86, 815 A.2d 1188 (2003). The inteweuing plaintiffs were all recognized by the trial court as intervening petitioners during the zoning hearing pursuant to § 22a-l9 (.a). In their response to the motion to dismiss, the intervening plaintiffs claimed inadequacies in the special permit process *92 and that traffic volume will have a severe environmental impact and thus were aggrieved. The landed plaintiff claimed aggrievement because he is the owner of property that is within, abuts or is within a radius of 100 feet of the 150 acre area identified by the defendant for the overlay zone. All plaintiffs claimed aggrievement because the approval of the amendment was illegal, arbitrary. capricious, in abuse of the colmnission's discretion and in violation of its own regulations and applicable statutes. 111 response, the commission argued that the plaintiffs were not aggrieved and, thus, lacked standing to bring the case. The commission filed a motion to dismiss on February 6, 2009. The commission filed a reply to die plaintiffs' objection on March 26, 2009. The trial court, Brunelri, J, granted the commission's motion to dismiss on July 21, 2009, by written memorandum of decision. This appeal followed. I We begin by setting tbrth the legal principles that govern our review. "If a party is found to lack standing, the court is without subject matter jurisdiction to determine the cause.... A determination *x673 regarding a trial court's subject matter jurisdict.ioi1 is a question of law. When the trial court draws conclusions of law, our review is plenary and we must decide whether its conclusions are legally and logically correct and find support in the facts that appear in the record.. Ill 121 We first address the judgment of dismissal as it relates only to the landed plaintiff The landed plaintiff' claims that the trial court erred in holding tlnn he did not have standing to challenge the commission's adoption of the text amendment to the zoning regulations. Specifically, he argues that he is statutorily aggrieved under §8_8(a)(1) because his land abuts or is within a radius of 100 feet of the area aitected by the newly created overlay one. In response, the commission argues that the landed plaintitfdoes not have standing because the text amendment created a floating zone. Specifically, the commission argues that the zone does not apply to any specific parcel of land. and, therefore, the landed plaintiff is not aggrieved. We agree with the landed plaintiff. s the .._. *94 We begin by addressing the defendants clauu that the text amendment created a floating zone. 4 By dethlition. 21 **674 floating zone does not apply to a specifically [which [3]141 [SI [6]"Subject matter jurisdiction involve authority of the court to adjudicate the type of controversy presented by the action before it.... [A] court lacks discretion to consider the merits of a case over which it is without jurisdiction... The objection of want of jurisdiction may he made at any time [and the court or tribunal may act on its own motion, and should do so when the lack of jurisdiction is called to its attention... The requirement of subject matter jurisdiction cannot be waived by any party and can be raised at any stage [of] the proceedings... described parcel of land.Campion 14 Board ofAldermen, 278 Conn. 500. 519, 899 A.2d 542 (2006). A floating zone "differs Hom the traditional 'Euclidean' zone has detmite bounds] in that it has no defined boundaries 'tloat` over the entire area where it mayand is said IQ 171 *93 "Slandnng is not a technical rule intended to keep aggrieved parties out of court; nor is it a lest of substantive rights. Rather it is a practical concept designed to ensure that courts and parties are not vexed by suits brought to vindicate nonjusticiable interests and that judicial decisions which may affect the rights of others are forged in hot controversy, with each view thirty and vigorously eventually be established." l"°'Sehwartz u Town Plan & Zoning C`on1n1ission, 168 Conn. 20, 22, 357 A.2d 495 (1975). In Schwmt, our Supreme Court held that the plaintiffs were not aggrieved by the enactment of floating zone regulations. Fila., at 25-26, 357 A.2d 495. "At the time of [the commission's] adoption the new districts, designated regional, community, and neighborhood shopping center districts, did not affect any particular area or property within WESTLAW r11 Douglas v. Planning and Zoning Com'n of Town of Watertown, 127 Conn.App. 87 (2011) 13 A.3d 669 the town.Ra Id._ at 22, 357 A.2d 405. In examining the Scllwallz decision. this court in Hives FamiLy Ltd Parrllershlp v. Planning & Zoning Commission, 98 Conn.App. 213. 222 n. 9, 907 A.2d 1235 (2006), cert. denied, 281 Conn. 903. 904, 916 A.2d 44 (2007), concluded that Schwari: is distinguishable from cases in which the plaintiff can demonstrate that it, unlike the community as a whole, owned property likely to he aliected by a particular regulation. Additionally, the Hayes court noted that there was no indication that the plaiiitiflS in Schw¢l1'tz even owned property whose *95 development potential was impacted directly by a specific provision in those regulations. only the possibility of an adverse elliect on a Id. "Aggrievement does not demand certainty, legally protected interest." (Internal quounion marks omitted.)Id.. at 222, 907 A.2d 1235. "Since the floating zone regulations establish a zone for a type of use with an undetermined location, the zone can technically be applied anywhere in the municipality. It can result in individual preferences and respond to development pressures rather than considering the best area tor location of particular uses." (Emphasis added, internal quotation marks omittW.)Campion V. Board of Aldermen, supra, at 519, 899 A.2d 542. [8]In the present case, the parcel of land suhiect to the commission's decision does not float over the entire *96 community but has distinct geographical boundaries. The text amendment creates a new zoning district, which the plaintiffs refer lo as the "Route 262 Planned Commercial District (B- PCID262)" for specific property bounded *k675 by Route 262, Turkey Brook, Echo Lake Road, Connecticut Route 8, and Frost Bridge Road in Watertown. The text ainendrnent defines the specific geographical area to which it relates. The newly created B-PCI)262 zoning district permits commercial uses in an IR-80 industrial zone. The text amendment applies to the otherwise industrially zoned area, and the commission identified the area "Route 262, Turkey Brook. Echo Lake Road. Route 8. and Frost Bridge Road" as die boundaries of the new zoning district in § 36.2 of the regulations titled "Overlay District Location." The parties do not dispute that the area has definite bounds. 'The area described is bounded on all sides and consists of only approximately 150 acres. Because this particular 150 acre area is affected by the commission's decision, the area atiected has descended to a particular pan of the town under the language set forth in Sc/1wurtz. We conclude that the text amendment sufficiently defined the specific. limited geographic area to which the text amendment related. and, therefore, the new zoning district cannot be considered a floating zone. The trial court held that the landed plaintiff was not aggrieved because no particular area was affected by the text amendment. The court, citing Schwartz V. Town Plan & Zoning Commission. supra, 168 Conn. at 23, 357 A.2d 495, reasoned that "there can be no aggrievement when the zoning regulations of a municipality are amended in such a way that no particular area or property is elected." (Internal quotation marks omitted.) In particular, under Schwartz. "[b]eti>re the floating zone can 'descend,' an application must be made for a change of zone and a public hearing must be held." Schwartz v Town Plan & Zoning C`ommission, supra, at 24, 357 A.2d 495. The trial court also relied on a more We next address the landed plaintiffs claim that he is statutorily aggrieved because he owns land that abuts or is within a radius of 100 feet of any portion of the land of the particular area to be affected by this newly created zoning district that permits certain commercial uses in an othewvise industrially zoned area. Section 8-8(a)(l), which governs planning and zoning commission appeals allows an appeal to he brought by an " 'aggrieved person'[and] includes any person owning land which buts or is within a radius of one hundred feet of any portion of the land involved in the decision of the board." A person owning property within *97 the designated distance of the land involved in the agency's decision is called "statutorily aggrieved" and has standing to appeal. recent case,Harris v Zoning Commissioll, 259 Conn. 402, 788 A.2d 1239 (2002), in which our Supreme Court further explained that the aggrievement principle set forth m Sheridan v Planning Board 159 Conn. 1, 266 A.2d 396 (1969), "stands for the proposition that a prospective, personal and legal interest in the subject matter of a zoning commission's decision does not satisfy the first prong of the test br classical aggrievement."Harris VI Zoning (`ommissiof1, supra, at 414 II. 12, 788 A.2d 1239. [9][10]In Light Rigging Co. v. Dept. Q/ P1/blie Uri/fry Control, 219 CGIIII. 168, 173, 592 A.2d 386 (1991), our Supreme Court held that classical aggrievelnent in an administrative appeal is established if there is a possibility, as distinguished from a certainty, that some legally protected interest has been affected by the action o1` a zoning authority. Statutory aggrievement, as opposed to classical WESTLAW F FD F F Fi F F F Douglas v. Planning and Zoning Com'n of Town of Watertown, 127 Conn.App. 87 (2011) 13 A.3d 669 aggrievement, occurs when a landowner owns land "that abuts or is within a radius of one hundred feet of any portion of the land involved in the decision of the board", General Statutes § 8-8(a)(1), and the landowner appeals to 15, 620 A.2d 1324. The plaintiffs had appealed from *99 a decision of the Cornwall planning and zoning commission that adopted an amendment to its regulations permitting the opexation of a commercial sawmill in certain residential the Superior Court. Citing Harris u Zoning Conzrmlssion, supra, 259 Calm. at 402, 788 A.2d 1239, the trial court held that the landed plaintiff had "not shown any aggrievenlelit." However, in Harris, our Supreme Court dealt with classical zones. I"- Id., at 512, 620 A.2d 1324. The plaintiffs in Cole owned land within 100 feet of the property on which a permanent sawmill operation was intended to be established in accordance with the new regulation.Id., at 515, 620 A.2d 1324. The court found that the plaintiffs were aggrieved parties by virtue of their ownership of land within the zone to which the amendment pertained. Id. Their appeal, like the appeal in the present case, was from the adoption of the amendment to the regulations, not from the issuances of aggrievement, not statutory aggrievement. See id., at4 I3- 15 and 415 n. 15, 788 A.2d 1239. Classical aggrievement requires a twofold showing. "[F]irst, the party claiming aggrievement must successfillly demonstrate a specific personal and legal interest in the subject matter of the decision, as distinguished from a general interest, such as is the concern of all the members of the community as a whole. Second, the party claiming aggrievement must successfully establish that the specific personal and legal interest has been specially and injuriously affected by the decision." (Internal quotation marks omitted.)Id., at 410, 788 A.2d 1239. Neither of these prongs must be proved if a plaintiff is statutorily aggrieved under §8-8(a)(l). a pen lit and site plan approval tor the actual use.Id., at 511, 620 A.2d 1324. The plaintitlk in ("ole alleged that "1a] permanent sawmill [operation] was not permitted on said property under the original regulation but was permitted In the present case, the trial court dismissed the case of all plaintiffs because they were not aggrieved. In the case of the lauded plaintiff, the court dismissed his case for lack of aggrievement although it ww676 fbund that he owned land that abuts or is within a radius of 100 feet *98 of the bounds the commission established as affected by its text amendment to the regulations permitting commercial uses in that area of the municipality, which, prior to the amendment, allowed only industrial uses. under the amended regulation."Id.. at 515, 620 A.2d 1324. Similarly, the text amendment in the present case amended the existing bounded parcel of IR-80 industrial zoned property to permit certain new uses, particularly, "high quality retail and office developnleilt," and to exclude other certain enumerated commercial uses. e.g., Laundroniats. In both cases. additional limitations to the text amendment were anticipated to be set tbrth in the permit process. In Cole **677 and the present case, the use was prospective but then was permitted by the new regulation. We conclude, theretbre, that tlle text amendment created a defined. bounded zoning district and that the landed plaintiit is statutorily aggrieved under § 8- 8(a)(1) because his property falls within the particular zone to which the text amendment pertained. The trial court specifically found that "[i]n the present case, the landed plaintiff owns land in an area, which the commission added an overlay zone."5 This finding is dispositive of our resolution of this claim. "Persons whose land falls within the statutory category need not prove aggrievement independent of their stars of owners of property bearing the necessary relationship to property involved in the agency's action." R. Fuller, 9A Connecticut Practice Series: land Use Law and Practice (2007) § 32.4. 1111 The commission also argues that the landed plaintiff is not aggrieved because there has not been any change to the zoning map, nor have any zoning map change applications been filed. Additionally, the commission argues that iiirther steps in the application process must *100 be taken, such as submission and approval of a conceptual site plan filed in conjunction with a zoning map application, belbre the text amendment touches or impacts any parcel of land. Whether the zoning map has been changed or further steps in the application process will be taken is immaterial to our determination that the landed plaintill` is statutorily aggrieved. The area is no less bounded than if it were delineated on the zoning map. The landed plaintiff, as an owner of land within the newly created, bounded zoning district, the area to which the text amendment pertains, is an aggrieved party by virtue of § p. 147. Our decision in Cole \'. Planning & Zoning ("omlnission, 30 Conn.App. 511, 620 A.2d 1324 (1993), is analogous to the present case. In Cole, we held that pursuant to § 8-8(a)(l), the plaintiffs were aggrieved parties by virtue of their ownership of land within the zone to which the amendment at issue pertained. 6 Id., at 514- WESTLAW F P. P F Douglas v. Planning and Zoning Com'n of Town of Watertown, 127 Conn.App. 87 (2011) 13 A.3d 669 8-8(a)(1). See C0/e v. Plalming & Zoning ('0111111is.s'i0117 supra, 30 Conn.App. at 511, 620 A.2d 1324. the text amendment pertained. We conclude, therefore, that the trial court improperly dismissed the landed plaintiffs case and reverse the judgment in part, with direction to restore his case to the docket. H 'I11e commission also argues that the lauded plaintiff is not aggrieved because a person owning land within the B- PCD262 zone is not required to join or to have his or her pl'operly included in the amendment to the zoning map. Whether a landowner may choose to have his Of' her property not included in the amendment to the zoning map, a future step in the process, is immaterial to our conclusion because the landed plaintiff is already statutorily aggrieved by virtue of owning land within the newly created B-PCD262 zone. The commission's argument erroneously presumes that the new zoning district is a floating zone. For the reasons stated earlier in this opinion, the newly created zoning district is not a floating zone because it has defined, definite bounds. We next turn to the question as to whether the trial court properly dismissed the claims of the intervening plaintiffs. The intervening plaintiffs claim that die court end in holding that they did not have standing to challenge the conduct of the commission in adopting the text amendment. Specifically, the intervemn'g plaintiffs *102 argue that the commission illegally failed to follow regulations requiring it to submit an environmental impact statement in connection with the text amendment. "We begin with some well settled principles regarding standing and its aggrievement component as recently reaffirmed in Windels V. Environmental Pllotecl'ion Commission, 284 Conn. 268, 287-89, 933 A.2d 256 (2007). If a party is found to lack standing, the court is without subject matter jurisdiction to determine the cause.... A determination regarding a trial court's subject matter jurisdiction is a question of law. When the trial court draws conclusions of law, our review is plenary and we must decide whether its conclusions are legally and logically correct and find support iii the facts that appear in the record." (Internal quotation 711e text amendment created the new B-PCD262 zone. a new zoning district with specifically defined, definite bounds, which permits development that previously was not permitted. In its brief, the commission recognizes that the new text amendment permits development that was not permitted at all in the preexisting zone. Even if the landed plaintiffwae somehow able to opt out of the amendment to the zoning map, lie is 110 less statutorily aggrieved because his land still "abuts *lOl or is within a radius of one hundred feet of any portion of the land involved in the decision of the board." General Statutes § 8-8(a)(l). The landed plaintiffs decision to opt out does not affect whether his neighbors decide to opt out and, consequently, whether the lands of such adjoining property owners are still subject to the text amendment. The landed plaintiff, therefore, is no less of` an abutter of some adjoining property owner who did not decide to opt out. "Statutory aggrievement exists by legislative fiat, which grants appellants standing by virtue of a particular legislation, rather than by judicial analysis of the particular marks omitted.)Pond View LLC u P/arming & Zoning Commission, 288 Conn. 143, 155, 953 A.2d I (2008). facts of the case." (Internal quotation marks omitted.)r'Cole v Planning & Zoning C`o1nn1ission, supra, 30 Com1.App. at 514-15, 620 A.2d 1324. The landed plaintili` only had to prove that he owns land that abuts or is within a radius of 100 bet of any portion of the land involved in the decisioh of the conJnlis>ion to have standing to appeal by legislative Hat. It was not necessary for the landed plaintiff to prove any specific aggrievement. The intervening plaimitfs intervened under § 22a-19 (a), which provides: "In any administrative, licensing or other proceeding. and in any judicial review thereof made available by law, the Attorney General, any political subdivision of the state, any instrumentality or agency of the state or of a political subdivision thereof any person. partnership, corporation, association, organization or other legal elltity may intervene as a party on the filing of a verified pleading asserting that the proceeding or action tor judicial review involves conduct which has. or which is reasonably likely to have, the et&ct of unreasonably polluting, impairing or destroying the public trust in the air, water or other natural resources of the state." General Stamtes §22a-19 (a).ww678 The text amendment created a defined. bounded zoning district, and the landed plaintiffs statutorily aggrieved pause his property falls within the particular zone to which WESTLAW F F Douglas v. Planning and Zoning Com'n of Town of Watertown, 127 Conn.App, 87 (2011) 13 A.3d 669 [12]Of the basis of this expansive language, our Supreme Court previously has concluded that § 22a-19 confers standing on a broad range of individuals, entities and *103 government agencies to intervene in both administrative proceedings and subsequent "judicial review" thereof on 22a-I9 (a). See Fort Tmmbz//I Corzsenfaneu LLC v New London, supra, 282 Conn. at 797-98, 925 A.2d 292 (plaintiffs claim that deibndants failed to follow cextain procedural requirements in adopting development plan inlsufficient to establish standing under General Statutes §22a-16). appeal. See Ava/o11Bav ("onImImi1ies, Inc. v. Zoning Commission, 280 Conn. 405 413-14, 908 A.2d 1033 The intervening plaintiffs also argue that they have standing to appeal under §22a-19 because of the reasonable likelihood of environmental harm as a result of the text amendment to the zoning regulations. Iii support, they argue that their allegations are distinguishable from those that undermined the plaintiffs' case in Pond I'7ew LLC, a case on which the trial court relied in dismissing their complaint_ We disagree with the intervening plaintiHs. (2006),Red Hill Coalition, Inc. \'. Town Plan & Zoning (commission, 212 Conn. 727, 733-34, 563 A.2d 1347 (1989). An intervenor's standing pursuant to § 22a-19 strictly is limited to challenging only environmental issues covered by the statute, and "only those environmental concerns that are within the .jurisdiction of the particular administrative agency conducting the proceeding into which the party seeks to intervene."Nizzardo V. Sraze Tiuffie C`omrnission, 259 Conn. 131, 148, 788 A.2d 1158 (2002). [13]In Pond Wen; LLC u Planning & Zoning C`on1nzission. supra, 288 Conn. at 143, 953 A.2d L our Supreme Court reiterated its prior holding that intervening environmental plaintiffs have standing to intervene on environmental issues only.**679 Firm., at 157, 953 A.2d 1. The court held that a person seeking to intervene under § 223-19 (a) must plead issues to be decided that fall Fi within the ambit of the statute.Id., at 159, 953 A.2d l. In the present case, the intervening plaintiffs set out numerous claimed irregularities in the manner in which the coinIuission proceeded. These are set forth in paragraph 24(a) through U), inclusive, of the complaint. 7 All of these subparagraphs set out procedural *104 irregularities. Subparagraph (i) comes closest to the required environmental tllresllold in its claim that the coinniission voted on the amendment without "defensible standards and without standards protective of water quality, erosion and flooding." However, even paragraph 24(1) of the complaint is really a claim of lack of standards in the legislative adoption, thus making it "illegal. arbitrary, capricious, and in abuse of its discretion, and in violation of its own regulations and applicable state statutes." The Pond Wen; LLC, court made it clear that the issues that the interveners ask to be decided must be those properly within the scope of the statute.Pond View; LLC' it Planning & Zoning C'ommission, supra, at 159, 953 A.2d l. Claimed noncompliance with zoning statutes or zoning regulations are not within that scope. Allegations of noncompliance with procedural requirements do not give rise to standing to challenge the colnmission's action pursuant to § *105 In paragraph 22 of their complaint, the intervening plaintiffs allege various enviromnental issues, including poor water and air quality, that may arise as a result of the amendment to the zoning reguIations.8 Relying on our Supreme Court's **680 holding in Pond View LLC. the trial court found that the conduct of the commission. construed even in the light most favorable to the plaintiff, cannot be bund to be lmrmtUl to the environment because the creation of an overlay zone is not conduct that causes environmental hann. "The cases wherein we have permitted standing under § 22a-19 have involved circumstances in which the conduct at issue in the application before this court allegedly would cause direct harm to the environment. See, e.g.,*106 Red Hill Coalition, Inc. v Town Plan & Zoning Commission, supra, 212 Conn. [at] 730-33 [563 A.2d 1347] (intervention pursuant to §22a-l9 on ground that proposed development of land would result in the irreversible elimination of major portions of prime agricultural land was proper but agricultural land ultimately determined not nature l resource within meaning of statute ...),M_)ufic Marinelzfe Aquarium, Ine. 14 Gill, [175 Conn. 483, 485, 490, 400 A.2d 726 (1978) ] (appeal from approval of permit to construct floating dock and other structures along river that would harm environment), see also Fort Trumbull C`onsen'anc\: LLC` V. New London, [supra, 282 Conn. at 805-808, 925 A.2d 292] (concluding [lj that development plan itself constituted conduct that could cause harm to environment within the meaning of § 22a-I 6, and [2] that allegation of violation of technical or procedural requirements does not give rise to claim of unreasonable pollution for purposes of standing under § 22a-16).**681 (Emphasis in original,*107,,9 internal quotation marks omitted.)Pond V?ew LLC' v WESTLAW F in FU F F F Douglas v. Planning and Zoning Com'n of Town of Watertown, 127 Conn.App. 87 (2011) 13 A.3d 669 Planning & Zoning Commission, supra, 288 Conn. at 159- 60. 953 A.2d l. In Pond Wen; LLC, the commission argued, and the court agreed, that a zone change itself did not involve " 'conduct' " within the meaning of § 22a-19 that could be analyzed bi' its unreasonable pollution effects on air, water or other natural resources,Id., 81 154-55, 953 A,2d I, The court in Pond View LLC, further stated that tlle proper fonun to challenge alleged environmental harm and related procedural issues under § 22a-I9 was in an appeal from the commission's decision granting a special exception permit or, more specifically, approving the site plan. Fld., at 161, 953 A.2d l. "It is this application that actually involves the 'conduct'that might lead to adverse environmental impacts that standing pursuant to §22a-19 is meant to guard against."*108 plaintiffs, we aHinn the judgment of the trial court. Id. For these reasons, as to the intervening We conclude that the trial court improperly dismissed the landed plaintiffs case and reverse the judgment in part, with direction to restore the landed plaintiH's case to the docket. As to the remaining plaintiffs, we affimi the judgment of the trial court dismissing their' intervening complaints . [11 this opinion the other judges concurred. [14]The i11te1've11ing plaiuti8ls distinguish the interveners' allegations in Pond View; LLC, on the ground that they were 1101 environmental. lo It is not necessary tor us to address this argument because the distinction, if any, is immaterial to our conclusion. The inclusion of environmental issues in the complaint does not per se provide the intervening plaintiffs standing under § 22a-19 or allow them to avoid application of our court's holding in Pond Ifiew LLC. The language in Pond Went LLC, clearly states that a zone change is a legislative action which does not directly threaten the environment. Fold., at 157, 160--61, 953 A.2d l. "[A]ny environmental ham to the 'air, water or other natural resources of the state' necessarily would result from the [comnlission's] conduct in actually developing the property,All Citations not from the zone change.as M 81 l 60-6L 953 A.2d 1.127 (.`onn,App, 87, 13 A.3d 669 Footnotes 1 General Statutes § 8-8(a) provides in relevant part: "As used in this section: (1) 'Aggrieved person' means a person aggrieved by a decision of a board and includes any officer, department, board or bureau of the municipality charged with enforcement of any order, requirement or decision of the board. In the case of a decision by a zoning commission, planning commission, combined planning and zoning commission or zoning board of appeals, 'aggrieved person' includes any person owning land that abuts or is within a radius of one hundred feet of any portion of the land involved in the decision of the board...." 2 Section 364.1 of the Watertown zoning regulations provides that the intent of the B-PCD262 zone is to: "Provide an opportunity for high quality commercial development near Route 8 along a portion of Route 262 and Echo Lake Road east of Turkey Brook within a Planned Commercial District overlay zone to be adopted in accordance with a Zoning Map petition on the existing lR-80 zoning District. The primary objectives of the District are to expand retail, office, and other compatible use options within the Town of Watertown, as defined in Sections 36.9 and 36.10, and to increase the diversity of the town's tax base." See also § 36.9 of the Watertown zoning regulations (permitted uses). 3 Section 36.2 of the Watertown zoning regulations provides; "Overlay District Location; The Commission may adopt and may amend an overlay zoning District, hereinafter defined as 'District', 'Planned Commercial District, or 'B-PCD262, to an IR-80 District in accordance with the procedures, guidelines, standards and conditions specified in Section 81 and these Regulations. On a lot or lots within the overlay District, only buildings, other structures, and site improvements associated with uses consistent with Section 36.9 and Section 36.10 are permitted. The outermost boundaries of the overlay District are Route 262, Turkey Brook, WESTLAW F FE Douglas v, Planning and Zoning Com'n of Town of Watertown, 127 Conn.App. 87 (2011) 13 A.3d 669 Echo Lake Road, Route 8, and Frost Bridge Road. The Commission may amend the Zoning Map to include all or a portion of land within said boundaries to be the B-PCD262 overlay District, A lot or any portion of a lot not within the adopted overlay District, as District is defined on the Zoning Map, is not in the District. The Planned Commercial District may be one or several lots, however, the Commission encourages all lots in the District to be developed as if one parcel, No lot may be developed inconsistent with the provisions and intent of Section 36, as determined by the Commission. The location, orientation, structure, texture, materials, landscaping, and other features shall be consistent with the character of the District, character of the neighborhood, character of the Town, the Zoning and Subdivision Regulations, the Zoning Map, and the Plan of Conservation and Development, all as interpreted by the Commission. Development of a parcel should demonstrate high quality design merit," The trial court refers to the new zoning district as "in the area generally described as land north of Route 262, south of Echo Lake Road and west of Route Each description refers to the same bounded area creating the new zoning district. For the purpose of this opinion, we use the description of the bounds defined in § 36.2 of the regulations. This minor difference in language is immaterial because the specific boundaries are adequately defined in both descriptions and the bounds are not in dispute, 4 The trial court refers to the newly created zoning district as an overlay zone. Citing Heithaus V. Planning & Zoning Commission, 258 Conn. 205, 21648, 779 A.2d 750 (2001 ), the trial court stated that "[a]n overlay zone has been considered a 'floating zone,' which is a zone that floats 'over the entire area where it may eventually be established' or a 'special permit' The trial court found that "the floating zone is a more proper designation [of the area in the present case], as this overlay zone is alleged to create a zone which will allow for zoning changes." The trial court dismissed the case based on a finding that no particular area or property was affected, the quintessential attribute of a floating zone. Despite the trial court's reference to this area as an overlay zone, whether the area in question properly can be considered a floating zone is relevant to our resolution of this claim. 5 See footnote 4 of this opinion . 6 See also }~ Staufon v. Planning & Zoning Commission, 271 Conn. 152, 160, 856 A.2d 400 (2004) ("we must interpret the phrase 'land involved' in § 8-8(a)(1) in light of the legislature's intent to relieve a narrow class of landowners who are presumptively affected by the zoning commission's adverse decision because of their close proximity to a projected zoning action from the arduous burden of proving classical aggrievement" [emphasis added] ),Lewis V. Planning & Zoning Commission, 62 Conn.App. 284, 286, 296, 771 A.2d 167 (2001) (by virtue of statute defining aggrieved person to include "any person owning land that abuts or is within a radius of one hundred feet of any portion of the land involved in the decision of the board," owners of 277 acres of town's 4121 acres of subdividable land were statutorily aggrieved parties entitled to appeal decision of town planning and zoning commission to amend two sections of town subdivision regulations governing lot area calculations, to increase required lot size in cases in which ponds, lakes, or slopes were present),Swiconek V. Zoning Board of Appeals, 51 Conn.Supp. 190, 978 A.2d 1174 (2009) (site plan submitted with zoning variance application showed that landowner's and trust's properties were abutting, and thus trust's property fell within zone of statutory aggrievement as required for standing to contest grant of variance). 7 Paragraph 24 of the complaint states: "The plaintiffs/appellants are also aggrieved because the action of the Commission in approving the Amendment was illegal, arbitrary, capricious, and in abuse of its discretion, and in violation of its own regulations and applicable state statutes in that: (a) The commission failed or refused to follow its own Regulations (b) Notice was defective, misleading, and incomplete, (c) the Commission revised the proposed Amendment after the close of the Public Hearing and did not re-expose the materially changed WESTLAW e F Douglas v. Planning and Zoning Com'n of Town of Watertown, 127 Conn.App. 87 (2011) 13 A.3d 669 Amendment to public hearing as required by law, (d) the [commission] failed to follow the mandates of the Connecticut General Statutes, (e) the Commission failed to consider or make requisite findings relating to the allegations of the Petitioning interveners, (f) The Commission voted on an Amendment without defensible standards and without standards protective of water quality, erosion and flooding; (g) The conduct of the Public Hearing was fundamentally unfair, (h) A Commissioner who recused himself from the proceedings remained in the hearing room commenting, clapping, and otherwise participating in the proceedings; (3) The Commission approved an Application that materially failed to demonstrate consistency with the Plan of Conservation and Development, (j) The decision of the [commission] is not supported by substantial evidence and does not find a basis in fact or law." 8 Paragraph 22 of the complaint states; "The plaintiffs appellants are aggrieved by the decision of the [commission] because they were all recognized as intervening petitioners pursuant to the provisions of § 22a-19 (a) by the Commission during the Public Hearing upon their allegations of reasonable likelihood of unreasonable pollution to natural resources within the jurisdiction of the Commission as a result of the amendment to the Zoning Regulations because: (a) The combination of environmentally sensitive resources, liberal provisions on the amount of impervious cover permitted (up to 75%) and inadequately-defined Special Permit process and criteria leaves the subject property open to gross development that can adversely affect water quality [through] erosion and inadequate storm water management directives and create down-stream flooding without meaningful review, (b) Traffic volumes associated with the uncontrolled scale of permitted uses will create dangerous traffic conditions, poor air quality and introduce pollutants in runoff adding non~ point source pollution to the likely unreasonable impacts of permitted development in this environmentally sensitive location. The traffic will unavoidably and chronically deposit polluting residues of more than 17 known contaminants on the roads, driveways, and parking surfaces including, but not limited to asbestos and copper, chloride, biochemical oxygen demand chromium, zinc, volatile solids, rubber, grease, and the like, (c) Pollution from automobile tailpipes increases the risk of asthma, lung cancer, leukemia and other ailments, particularly in people who live near busy roads, The proposed Overlay District relieves an applicant from providing mitigation for increased congestion as a result of development, expressly counter to the CommissionS mandate under Connecticut law, in the streets' [General Statutes] § 8-2, that is, 'to lessen congestion 9 The pleadings and circumstances in Red Hill Coalition, Inc., and Mystic Marinelife Aquarium, Inc., allege direct harm to the environment and are distinguishable from the present case. in Red Hill Coalition, Inc., the pleadings alleged direct harm to agricultural land which was the subject of a favorable report of the Glastonbury conservation commission.Red Hill Coalition, inc. V. Town Plan & Zoning Commission, supra, 212 Conn. at 730, 563 A.2d 1347. Further, the commissioner of agriculture and the commissioner of environmental protection were granted permission to file a brief as amici curiae in support of the plaintiffs. ld., at 729 n. 3, 563 A.2d 1347. The trial court conducted that because the planning and zoning commission considered environmental issues by reviewing the conservation commissions report, the intervention in the zoning commission hearing was appropriate under § 223-19 (a).ld., at 733 n. 7, 563 A.2d 1347. The interveners in the present case did not raise such issues. In Mystic Marinelife Aquarium, Inc., the § 22a- 19 interveners appealed from a decision of the commissioner of the department of environmental protection granting a permit to erect a floating dock directly in the Mystic River. I *Mystic Marinelife Aquarium, Inc. V. Gilt, supra, 175 Conn. at 483, 400 A.2d 726. The interveners pleaded direct environmental harm under General Statutes § 25-7b, which "places upon the commissioner the duty of regulation of the erection of structures in tidal, coastal or navigable waters with regard to be had to certain considerations set out in that statute."at 495, 400 A.2d 726. Again, the interveners in the present case did not raise such an issue.Id., WESTLAW F P Douglas v. Planning and Zoning Com'n of Town of Watertown, 127 Conn.App. 87 (2011) 13 A.3d 669 Instead, the intervening plaintiffs argue that the commission iliegatly failed to follow regulations requiring it to submit an environmental impact statement in connection with the text amendment. 10 In Pond View, LLC, the interveners alleged that they had standing to bring their claims under § 223-19 because concerns related to the preservation of natural resources underlying the town's plan of conservation and development provided a basis for the commissions denial of the proposed zone change and thus bring the issues in the appeal within the scope of that statute. supra, 288 Conn. at 154-55, 953 A.2d 1. Pond View, LLC V. Planning & Zoning Commission, End of Document 2023 Thomson Reuters, No) claim to original US. Government Works, WESTLAW ,.,. Tab 2 5 s in- _ l a :I , 0M..|m ; ; *-~_ Si f A . 5 'w2 3 .!/ .4- 5 Qww 3~ 4 4.' 4 1 s a I I - 'N I: 9 s p pa»» ».; o 5 SOOFT.ER WN s MA LEW £9 ..mm DSO EV so 1m1 45 hn50D .1 4 W559 38 . .aaouc SOUT ochoa i LMSTR T I C DCT06082 MO S CTEO?so 34-LA CA VW 44ORCTGGGSS RO 440 uc u.:BO LA TX 75092 TC OCI GTON CT 06032 . !.I -15-no ARTLETT S M LLC ?see 2 CDO in) COT?L AZ 852 l EV 38 ST76 5 0 250 m ET DSORU06095 aa-5TE£T00 3 8 7 T 9 5 7 as GT TH o s o a c r o e w 38-STREET RA i. 1 EMI TR ET SIR CT 06074 99 38-24 STR T60 ETMA DMD; acne TH DSO CT0607 I 38 STRE n as F/U o r TH DSO or 6074 .cm 45.* 1D00 EVE 30[EV RG u~en E V R G E N A STY CE TER c EV GR YSTESUB TH SORCT06U74 . RA{W? DSO L C 2240 LAW ST zoo Rf:o3o2lJ5 e t RG 38. RA 507 of TH Ds CT CA DW TERRA SOR CTOEGT4 LLC ENaaosraa WCHCTGESSD i"" Eves 3S C QGGHF IOOOLO EA UTH U.C 405 TH FTE oz LEY 44321 EVRG12DGE.D sou. c RQ AS zo C a r o to TCH ASSOCIAT c u r v e SHE 1000 ON CT 03132 DO 3 SEDO AC IC r - E * 1 CL EER J 62 i l 822,zo 3LE MA ;I DSORCT06074s o H T o .82DSO crusoa1SOUTH RA35 u c 50 EV GR 5 503 UT 50 CT [EV ENi v 24€loTA ARE EVER FN L SOCI TE 164 SCQWSDA be U S E 4285 my RG I 25- RA REI5 RTI£Si.L EA a n Gr o CTOSDZQ ea ZEOO lAMA C s o - r s EVER EN ICAL s o TE 64 20 C0775 AZ 85 9 {EV 'S S 3 T l G o S: G z o AC E5 RY E w w w LC D w~w~ T D ILHECK 1" = 100' so.: MAV 0,2023 13511.w0s9 we no ZC x I q 4 \ M \ U 7l/T879@$7 \ G D \ - 1 51-34- 419 RC 38»1 395 RC l 1 I D<Om o 3xU3ca l 81 * I I / \ I ii' / v r 4 4 0 DEMING STREET ~. 4 3 2 GD ". 4 --.. I \\\\\\ /z4u 4-vu\AA-30 \ / 0 Q3s-3 247 AA~30 / / -_ 1 38-27 2 GD 38-27-1 2 4 1 AA~30 38-2 2 4 0m - - _ . "--.,. 3 8 - 2 2 - 8 // Q W 38-24-2 260 APPROXIMATE msrxws BUILDING ouTunE (TYP 3 8 1 6 ¢ A A - 3 0 /// II I / / i Ki I 38-25 1 5 AA-3 3 8 - 1 2 8 c AA» 3 O6 l I Q'3; \ \ I s O /' yew\ 39-53-1 25 AA-30 MAP NOTE: INFORMATION CCMPILED FROM AVAILABLE TOWN OF SOUTH WINDSOR GIS INFORMATION ON MAY 2, 2023 AND SHOULD BE CONSIDERED APPROXIMATE. 3 8 - 2 P A RC E L NO 2 4 0 LOCATION ADDRESS ZONING DISTRICT ZONING DISTRICTS LIMITED RESIDENTIAL GATEWAY DEVELOPMENT MULTI-FAMILY ASSISTED HOUSING RESIDENTIAL/COMMERCIAL 83 as mm RC RESTRICTED COMMERCIAL RURAL RESIDENTIAL O4/_ .. I :w LOCATION MAP: SOUTH WINDSOR FARMS PRDPCO LLC 315 NORWOOD PARK SOUTH nsanwoon MA Anna; E 3 E i 4 67 .7347 we o W sen.: I~. 'aw p'-"m l 0 . ' W ED.o n. m<2 3. LU D U3 _2I<O LLU]_3 '_i3NE EE38 88 m|-4D >' *9 ~l&l I I I I >-_J |-zl.ll n-D u_o-L)mz 3[L U 8' m|- oto 10 w 3 z §Enu I Q *: o 68 (D 1 i I i I le r ? I 1 A I .1l1 llI i l I RE O i I as I I cwmv* say ,.,,.,.m . i 15.5%PETITION % OF TOTAL 7.16 AMOUNT OF TOTAL ACREAGED NEEDED FOR 20% Address within 500 ft.Acreage within 500 ft.Address of Signor Acreage within 500 ft. 241 Deming Street 247 Deming Street 260 Deming Street 301 Deming Street 8 Grandview Terrace 15 Grandview Terrace 25 Grandview Terrace 28 Grandview Terrace 35 Grandview Terrace 20 Sele Drive 32 Sele Drive 33 Sele Drive 0.76 0.72 1.19 0 0 1.41 0.06 0 0 1.14 0 0.28 340 Buckland Road 419 Buckland Road 432 Buckland Road 440 Buckland Road 176 Deming Street 200 Deming Street 235 Deming Street 241 Deming Street 247 Deming Street 260 Deming Street 285 Deming Street 15 Grandview Terrace 25 Grandview Terrace 205 Oakland Road 3.35 0.003 8.89 5.1 0.22 4.62 3.25 0.76 0.72 1.19 0.004 1.41 0.06 4.29 1.14 0.28 0.53 PETITION TOTAL 5.56 20 Sele Drive 33 Sele Drive Evergreen Walk TOTAL ACREAGE WITHIN 500 FT.35.817 Tab 3 CRUZ RAUL PROPERTY WITHIN $00 FEET 241 DEMlNG STREET SOUTH WINDSOR, CT 06074 TETREAULT NAPOLEON A II! & 3ENN1E L PROPERTY WITHIN $00 FEET 8 GRANDVIEW TERRACE SOUTH W1NDSORyCT 06074 SIGNATURE 7 4/4 2 f SIGNATURESIGNATURE 44 J/440/14.4/1 e378€4Q" / DATE 970 §`u.n-6' '949 DATE I 51.693 L n 09 *.,4 a GLOVER MARGARET A PROPERTY W1TH1N 500 FEET 247 DEMING STREET SOUTH WIND I CT 0 ) PASQUALONI PAUL TR PROPERTY WITHIN $00 FEET 15 GRANDVIEW TERRACE SOUTH WINDSOR, CT 06074 In SIGN.TURE !""'/`)4WM? '1 m Y\./CO:', ."AP"'J\q SLGNA 4 f \/ DATE /7 » 44/4 Q24 DATE UP v3/2-048 Petition against Zoning Change from Buckland Gateway Deve opment Zone to Multifamily Assisted Housing We the undersigned protest the proposed zoning amendments for the Buckland Gateway Development Zone set forth in application 23-25P submitted by The Metro Realty Management Corporation received by the South Windsor Planning and Zoning Committee May 23, 2023. We are owners of twenty per cent of the lots within five hundred feet in all directions of the property included in the proposed change. We understand the proposed changes shall not he adopted except by a vote of two-thirds of all the members of the commission. The applicant name and summary description of the proposed rezoning is as follows: Name/Description: The Metro Realty Management Corporation - request for a zone change of approx. 4.82 acres from 8uckiand Gateway Development Zone to the MulNfamily Assisted Housing (MAHZ)" to include a portion of 240 Deming Street (4.82 ac) and a portion of 440 Buckland Road (.36 ac), including conceptual plan in accordance with Sec 7.22.2.A. I I PHO LOC H & TAWNY PROPERTY WITHIN $00 FEET 260 DEMING STREET SOUTH WINDSOR, CT 06074 FARACI BRIAN & CARIN CG;/li, PROPERTY WITHIN 500 FEET 25 GRANDVKEW TERRACE SOUTH WENDSOR, CT 06074 SIGNATURE 24 , /6~» SIGNATURE 4,SIGNATURE SIGNATUREIDATE 4' -go,r DATE RAJU UDAI K & PROPERTY WITHIN 500 FEET 285 DENTING STREET SOUTH WINDSOR, CT 06074 PLEIN WILLIAM J & COSME CLARA PROPERTY WITHIN 500 FEET 28 GRANDVIEW TERR SOUTH WINDSOR, CT 06074 SIGNATURE 4p I SIGNATURE C9,Je»z4' SIGNATURE /~9 DATE xx w DATE ca"'43 SANGHANI KAMLESH V PROPERTY WlTHlN $00 FEET 301 DEMING STREET SOUTH WINDSOR, CT 06074 RAVIWONGSE ANUWAT NAN PRQP5.RT{ wlTHzr~l SON FEET 35 GRANDVIEW TERRACE SOUTH WKNDSOR, CT 06074 5SIGNATUREM I/C9 SIGNATURE / @@lm~DATE Zc)Z3 DATE CO 6 Le/ 'Ld L_] I _ BASILE MARK T & ROBERTA L PROPERTY WITHIN $00 FEET 20 SELE DRIVE SOUTH w1nos9;z,/cT.06074 ATTIANESE VINCENT & ANTONINA C PROPERTY WITHIN 500 FEET 33 SELE DRIvE SOUTH W!NDSOR, CT 06074 I IA 4I I 449/ eIf1 1 .J ~~» I SIGNATURE A. J SIGNATURE 8 LR .»xr be.. SIGNATURE /¢m¢»». $*G!**"*TU!*E(l Lf'LJ"7L&l\iQ (I t§!,i"hc<l\I DATE 7,i2§ 33 2393 2.98 `3'DATE 6% In /n . MARGIOTT PAUL R & VlCTORlA A M PROPERTY WITHIN 500 FEET 32 SELE DRIVE ) SOUTH wzmoso ,lcy9@8)74/, 'A w I9/.24' /% 6/4,/VSIGNATURE 4/ SIGNATURE//DATE "7/3;*/-\ 'x I1 I _.I ;-Ialx g\».a»'-FC"K l \ *53\ i 2% `\um-..:..I 4 'w4 4/f l1 I 4 '-._ '.l""3W'_I 8? -. n 9-= \_. I' ,_':'- 44 ""-_-., N QQ; . Q -._.. .-._ "y ......,-.Qliw 4 _.._._ "1- I r' f -"`"'z1}*am," .-1 QUO_Mil ':.'l:¢ l:> '> \ we l.....,.,,,I/fi'I w.-_-»~lIl I'ii .."~-.4_.- \\. I*QUO . V*-~~C34 l"" ;?.AZ__ 4: off _,R vs; go \ .§\ /MY ? 8_J r14'Q. Q " Ju x0 I; / I'92=' /4' 4//.1 eE>. -'7 ./*=¢§§4.~., /2 H'ru -.1 x "'--T'-\9,x ____:1 ( .» /.\l-__-/ . r.. .I . I-.l~/"`f /f4t>~>:{ / , Jan \ q> , ( Il8J e/I l'"'r°-"r__._.. 4 /1'1CP £3 14-~- * I InI f ~~@cw"`*_ c:/" 4; .. "'~,~~_ /e * "`\._* "'x rf8p An £7 ;*t4§/ J~»v Qi,'°`'\I _p ,Q'<:~l'- 44.., ~\ .f. '~.\.'\\ o ~4_,_.\. ~44 ,f If .39 ` / »~..4 4 8\-"7 412;,*,'&>.£'x 1. 'JP-,\1*-.,,7 ' ' 079 . ,i 'G \|_*\ 4'_.l ~.."sl»m v ,'w-~..ii-.* 4/.4? . W g fx /9 .?`?~~.<'\\" (al f 44,,'IJ /' / z "g M #'».~*4;°Zn-4 . 0 4 4 3 .~..._.1 -m w ,L 7 44 ~». o |! 4?o'' Q/I 11 l*'°-L~ .9 % ~/»=:> ,w . /=' Ra -"8/t"'".n I1 ,'~--».. 5 .._.D '~"-..»,-\-..-. -L_..1'i=_..gQ.~:.f.*3 1'i:°""r~-_ T" -\\I u 'U .Q 9 lE44 {. `°'~.\*_':I ..,I"'--Q": |*`--»-41 '1 [f\,*~£`\>I''°-/~~='.('s»"~ UQ. ""'~. a.`kw' 18 ""§*~¢',/ n"'a <=/ *57-3.i`i0 85" *"n'%,£ F -*'"`9*~~./I*'-.,;,»> M-"€3» .4 -r-»..-¢\4w~~igj\_€<. .§>~ /'-1 84 .0\l< -.q;-'c .| '=' !-'Q 4 Q »|x .-a.,, 4 l_.@§-.9 4 ~''gr \-v'~Qi Z'~'-.,¢ ""9~'t» "*7 w 4 .49 4./ "`-`\_l*!,1 f'°°'=»-!J r ~».J'R*.3 3\~'I ».r ""~~J! ¢i .-9 "'-4i z \ ~).1 f/I. -I"-~-4!3".r 1-If 's=='*,\,f "'*".{Q "'*\,.'1 . j <3 ?*- 33)".:"~~.»' I 3 " ' ~ i `- ...*F *.' 4e ,I j `/ I *ifr ""4_/ .r /" ._r kg / \I \IfL . J./ 148-J J .1-,! 8 Qb.. Q Ih-I C* .4, 9 "`mll_,U ""8°»§' g 39,or ,.»-r'"l""'"w I ' f 4 \___ 'i r"°° *`.2. X-CJ .we 1- nif "4I al: J -1. I. , IJ 4 ""4 __*;»' 1'.~"ll."x A. 3 ,~ r 1Ip.._ E\v__rJ*u "?_-4: Q»f . U _,_ r --.u l`*~M 0' *.'<a1'l .1 A '\.~c'..,M €_l *._§~-.»Q""j.) ~-: : /'*\_ £3"l*P*-~._f ` \-V 'II,°~>..g..'-..<sf '*'-'/2;t}<7 '%fof'*<'/ "v. q .,I ;.-_»'L,I Q; <4 .,Y" v~ I*~\._ e..\\ <4 ,'F by/ x -.if "1 *, \o 4?-~ /1 *Q3/-C}', IN)r "'-.'_\I(-421,-64 g ,- ¢'~\'1 *in ¢»Wé/i .l 98 . 53 £4F ';'~K-1.-. 2.9 r '1~\ >>Y='g!l*~..¢' 9 x "E"//' ' "4_¢>,q,-*<;,°' .1" 0"~*"_.@, I £'@=/,(I."---al___-(9 .I *~.~Y(' m"~~.°. f""T(:~~. l?) ~~=~~$==,t-~~~J .F`i9°3?*~41 -/fnl\"'¢r-..,JQ "'\~~....;. my I ex 4*J ,g .<;~._{:»~ ";~...;,9 3;.~. '.*'*':§!'If ~9"y" .\¢_ ""'` `"~-J "--.-»w 3.!~~iv @"*,§'_.Q g,f '4I._r. F {<~--_/'J 93; is~x.l~*"s '."-/ii .G*/4 00,49 v4' ¢'.S»' '\ I ,I . Rx' g* Me.. ..; t£?'*'~" f~.-/'--"mm -..-.m ..0 \~'I QR, '3i'4o'-et,'/-_ ¢' *~¢9`-,I Q. -av »/B-¢. 1?/'0"-I .'\./,»'~~, ,-,3;~,.",4. I AL31 :J ~.~4 0W1'41 *32...v;G2T_0.n 3.(>¢-lg Y'- Q;l #}L1§If . "in i 'm "r-...L /:.,. "'~ _r "\.'» <).-|/)*xt \¢?\>~=". `&Q/ / /'°/ ii '3,f*~"o »f~-,.I ,2 t ; Y o ,»y\ :,.{»;.-,9 *..... -~ /My PM .h 0 9 M G":/ )§,s:>, ..{\ 4:5-, /M-,, =*»2»...x sit*J, ,2'AM (f LF;-firm-af;-¢»/'n=~ 0.9_1 . »'¢¢1?'¢J»lJ'49 \in.. Q'v . .G\2" '~U . `\,.X`*»,0 '»~ 0 24 /'.,§~ 'S .I ;,/*-~'S.,='»' Go!F" r-/'i}§~ //"--.'*~L>I ~.._.*/'-*3=?-_,_;°4z',=''»/**--\~.."n Q: \§_1-4 4°f;-._ 9- \~.9'{>»."Q" "£`/-J 4n "Z.!/JT" / My*".~* Q 7 .1 ~..1Hoi-Sux/*n R ,`~?',/$ . *d \»f?_.- *-~~,4__c» 4 §3l1!/i`,_ 6/19/23. 12:58 PM Print Map Town of South Windsor Geographic information System (GIS) 6 Data Printed: 6119/2023 i N Approximate Scale: 1 inch : 200 ft w -I MAP DISCLAIMER n NOTICE_QE UABILITY This map as for assessment purposes only. It is not for legal description or conveyarmces- AI! information is subject to verification by any user. The Town of South Windsor and its mapping contractors assume no legal responsibility for the information contained herein. E S iI https://soulhwindsor. mapxp ressmel/a gsrnapi iii .9-Nan .E 'E E 88 in'Fl 8 oo8 3owo Qoao -=tNQLDQ oQQQ<rr~oLDO 88mmc>LDO 8QGINmQupr- ooooNmou>O ooDoomNmon oQoDVImDnoD 88 NmONo 88<rt\QLDo 8GQ R'omO 3 v Dmo 8oo EQ£0o § vI.oLDQ o8o<1homo 88 ii8o oo8 mQNQto 88 <rA8o oODQwz\OwD 3 9 oma 8:8vRxomo O 3Q FEonoQ 88Q-r\O*DQ Qooo émnoLDo QooC \"|Nm 8 oOoo co1-1vQ- Ooao ivinQmQ O 8o qNw|\D oQoQvnoLDD ooc:a q-NoLoco OoDD vr~osoo 88WmNmto 8 mN8o oDoo|3Nmca 88¢o\D-ru1-»m4-vLn UDC to E >~ z B U B 13 5 1-u N<t;<E L:6 15 F3 £3 B U Ou U U U 'G b B c IO IO C -\Z U 13 U N<U 2 ii ofLJon.c m2 >¢M O>- 3LLP 2 D....| *in*u..2Lu ocomag3IF-3Om mOupoz3I»-DOm moviD 3 3 LuM 5:|:| - 3 om zO|-U3Eetql-L. 38 E8m 1OanQ33 DoO3xoz moma _z 3 II-Dom ac 53o33I|-:aoLn m8az_3 33om UraV)Q E3 goLn ac OmD E g E3OV) xOUPoz3II-DOm of 3D ; 3 Ir~3OU) MLU>2LLIo xOinD33I»~3Opa momDg3II-3O UP orOma;3Il~DOm mOVIo Z 3I»-DOLn a:Omo E 3 I|-=>oLA M 9a _z3:|:|-3om :c 23z LL! KL)nrw >-DJ._|c. ou 2 9 3u Zo|-LD_z3ac<u. x\Llr-vsO_|U mOUPa E 3 I|-3OV) or oVIQ E 3 II-*~3Om ac 9a E 3 I| -D om Lu._| <aVI r :OL)1/1 ZO:-Ln2:..1UJ L.u_I<om ELJLE orOVIa 3 3 Rx:I-3OLn mmM ' n9q DDc m E ULDLu|-m|...VIZOpaO3ILnq-x-1 PLunuz)-m 2__|LLJNNr~I 3Om 3Q-KG2:_|lu <rQI\r-( 2O1Zo|-w_z_1-Ju.l<r -I LD x Om OQ. O LU>_z2 Q' UJs 2 us '5 >< 8M xO u.: D. KD asD Q.1 <<ZOaUE U.)oomv\ F-LIJLU,or 'S 3Oa¢mamN II-2Dm¥ac<a.QOQ3Eozmv-4en a<OmzQLEz_..|-JLUvvr~1-4 |-wmn:4-va w _z2l-uDovN LElA.l Em (D 3 2Lu Q H wN LEu.:cc| -an LD E 2LLP a <1-N EMS LE 3Eu.lDoIDN F-I-IJmml~m w g 2mo mmN »-LuLU5UP LE _z § Ll-JDviom Qoivu.l IZ1-mLA.184 5mo 3N 3m gom BE3 §s_Q 33 585 z\l.l8 l.u ;8 S\u 3 z>HJ <3 8 LD U 15 un co 9 FG 8 l-IJ 31LUI- E2>az<ac LDmin o:OO in.| Qofm aas +-<om 2 <cLIJ|-LnDLDm NOFEmLuI;Dvaom OmIr-On: mov Nvv-(n D<Oac Qet<rIof 8oNVIv oQDv-4 LU|-mLu2n:a LU2|-3LJUJxLu LD as lIJ or E Q oNI-i | -UP Q I -zo ac 'LJQ. !\in Lu 2o: O LU. ILUUP oN HJ 2 ac o u.:.Au.:vs Nm LU 2 ac Q LIJ...JLUi n mm QNmLUn-UPDM LU.4<D EoUm2mm § oNmLU|..mQm o E lIJ Fr'as D2moE LJLu Lnvi Z< mg morm wN FE 8 LU9- 1-/7>-<gzu.:l-IJacwmLU>w r-4om W 8 Z 25c 8 u-.I_|VuzLU4O_|w>u.la o:OmOE3 I|-Dom IOmOZ 3II-Dc>wu.o>-_J E<rLL 21:mDozZ<I L)_J-_J 3_| m2o22OUoZSXu3m 3.1 VuzoE gL)Dz5xU3m L)_J_z >-Z<o. § ou °5 2 o2 3 u_J._|D §zU3m Qm3I_Jwm I-LJx>¢ u.» : Lu Ln m o I*- 2 m r - S U O < I a 8 > - o :xLUm u.J_Jl.IJ 31-m83 IILU.JmI-<m D2<rVI4.9E><VI_J 8u.lQLL!u.zOvia3 3 L)...I.J Ouo.Oxo. m 2m 8 ofomQ E 3 ,Jg:>am U.J_J9-2LUE IZLU>33O8 17< VIE.-'_rm 2Lu 8 LUI|- LLO1:LJof:>zLJ>-of<> 3 _|D<o:NDmu <l~MJm 8M<21iio_Ias >~z 31- 95I L.)O_|oID. DO x 23 3 8 >Im.is25 E<Iwz5 L)...J_I 'E 9Oz_3<mI DLJ u_a_Aoru.:|-ZLuU u.l E8u.:¥ In'3ZmlumcaxLu>u.l .J 'L-'zzLU no 2ZOUJ_»o0_<Z53<u.lZ ET|- mr-43<Q.. 2O To'D 3B. zE8 96 ZSacm G8 as 06 2 3 : I § ELU...Jm Z<Z 'E3D2<inL/1 go 35><rac U_._|..l LDzGmOMuzu.llk-1acupofLU>"'r'_|vs3 UjmomaE3 gOmaIof U..|..|co 8QE3 gOmOIm |-mLU sUOmva< 51-<n. >-acMwm Iu.l..|uasLJ<ZOoLUwo1-1 _| <rI'-MLIJm oof w I'- >¢or < E I-IJ=' 3 2< isMO E>°0m _J:<Q. t: QUz<E U<52oI-2<°5|-z LL]L)3> LIJwLuZS E 3_J 3LU|-Su 9Ln< _A<EQLu2Z LLJLum LDo¢UJ>LU U-J_| Q ELIJ0.oaso. Ew< 3_JviLI-IP' S.L)oVI9 3ELU22 \-LJLu¢wmu.l>LL! L!_|_I =-1< [3acD<oacoZSh¢L)3m 5;ML."D'U< 8.1.au m 23Ln3u.l1BZ<o1_n o<ooroZ5¥u3mo <1-m o<OmDz5>¢u3mDLnm Q<Oma 3ML)Dmamm Q<omQz 3xQDmmFlQ O<oacD 3¥L):>mNinv D<oxQz :s>:UDm m32l.u><nr<au.lLl 3 |-LUm 8° L9 g.2HJQ LDle 1-4 r-LuLIJ g w _zEDJaQON r-u.lLUorI-II)LEE2u.lDInmN I-Ll-ILLJ g w3Eu.lQ 5;N I-LuLLIorI-m ,LDIZ 2LuQii<1-N |-Lu.u.:acI-vaU_z2l.LIDr~<1-N I-Ll-Ii-IJxi-mLSEELUaD\DN )-HJu.roc|-mwE Enuamnois *_. w gr-m w 3 EkJ o HQt*'5 33zLUwanLEmLu>LuoQOv-4 >~ < 3 ZLUw cc upxLU >LL! Luu 8zLu1- 33OZ 8wof u.lU 8acLIJ|- 3 8>D z<M nomr-e LLIU 8 3|- 3Lu SD2<mwmN u.lL)§zu.:|... 3Au 3ZélD ooN u.l 3 ocIU >-v3LL! >az <ror LDmm u.:3z LIE><xLJo_I2LuI § E 5u.<I-I-J-Jwzo.1QOQ9-¢ nuZ3 LL 8.5LDZO.1 8Nv-¢ O(Oonoz3 >¢<o 8N LU_ | 4.) O QLu 5 u < Z 1/7 0FE I BJ 2I Q u.l_|LU UPDN1 LU >_m O LL!. 1L\.lam m"" I u.l 3acD Lu...ILum mto DJ 3 ZHJ >q :¢LJ <cm < 2 <)- §N Lu D ZLU> < 5 8 <r Z(| - Flczr--N z < L)< E wDUJ> x et< <1-9 u.rL)8Q:LU|- Luu gmLu|- l.uu8ILuI- E Qv .m mQQmm mH FE u`im o o h99888993v-(l'{\-1 »3"82393§§§§§§§§§§§l§l:II; 4 Q98 8 é'2 ,-qNm OQoOQmFIm no 8 3r \1\m go8o E, NN noN 3D|\min mmoDQ|\Nm 8moinm\'1v o Oo o 32 2 8m If)w w r-<r q mm m lb O1-1 8 RF(on mNmN<rN mN LE: N N ccN N za 8 9 9 NN U!o O ~§8.\GOnom ¢NQ8DOalto N 8nol'4oo mm 8OnoHto QoWNOmawm HohNoin0\no QonoNomU\oo mm 3,mm ccN mN om Hm Nm mm 8 min wm...c 3U FE N m <-UP so N °0 o»OFE 1-4 v-4 Npa mH vv-4 Ln14 goH r-v-1 mv-4 QPl c>N HFJ EoQ8UB.cEo'o<.I-32 E2ZoL.). oVIQ8>>I|-2ovsILOZ 81- I-La 8L' N(D inc. is 6 64000297 v1 SUPPLEMENTAL MATERIALS OF APPLICANT METRO REALTY AUGUST 10, 2023 REZONING OF 240 DEMING STREET AND A PORTION OF 440 BUCKLAND ROAD Applicant: Ben Tripp EVP of Development The Metro Realty, Group, Ltd. btripp@metro-realty.com 6 Executive Drive, Suite 100 Farmington, CT 06032 Agent/Counsel: Timothy S. Hollister thollister@hinckleyallen.com Hinckley Allen 20 Church Street Hartford, CT 06103 (860) 331-2823 64000297 v1 Table of Contents 1. Memo to Planning and Zoning Commission 2. Supplemental traffic information prepared by Mark Vertucci, P.E. 3. Additional information regarding expected school-aged children. 4. Further information about sidewalks and pedestrian access. Submitted separately • Revised conceptual site plan • Slide presentation • Professional studies demonstrating that multi-family affordable housing does not decrease neighboring property values (uploaded to online application documents) TAB 1 TAB 2 \\Private\DFS\Projectdata\P2023\0453\A10\Traffic\Response To Comments\(00) 240 Deming RTC.DocxCorres. 146 Hartford Road Manchester, CT 06040 t 860.646.2469 800.286.2469 f 860.533.5143 www.fando.com Connecticut Maine Massachusetts New Hampshire New York Rhode Island Vermont August 9, 2023 Ben Tripp EVP of Development The Metro Realty Group, Ltd. 6 Executive Drive, Suite 100 Farmington, CT 06032 Re: Revised Trip Generation Statement and Response to Town Comments 240 Deming Street South Windsor, Connecticut Fuss & O’Neill Reference No. 20230453.A10 Dear Mr. Tripp: This letter will serve to respond to traffic engineering comments received from the Town of South Windsor Engineering Department via email on July 6, 2023. In addition, this letter summarizes the reduction in trip generation expected from the proposed 240 Deming Street development which has decreased in size from 72 to 55 units. Response to Town Engineering Comments The text of the comment from the July 6, 2023 memorandum from Town Engineer Jeff Doolittle is provided below in italicized text, along with a response to the comment following. 6. The Traffic Study needs to include all other developments in the area that are approved or have been submitted. This includes future developments along Buckland Road, Gateway boulevard, and apartments/other units in Evergreen Walk. Response: The 2025 background traffic volumes provided in the Traffic Study included all proposed but unbuilt development at Evergreen Walk including the Whole Foods and an additional 165 residential units. In addition, the background volumes included an annual growth rate of 1% per year to account for normal traffic growth within the study area. In response to this comment, the 2025 Background traffic volumes were further increased to account for traffic volumes from the approved but unbuilt commercial portions of the Gateway development on the east side of the Buckland Road. In addition, the Synchro capacity analyses were updated to include the additional background traffic volumes from the Gateway development. The revised volume figures and updated level of service (LOS) tables are attached to this letter. The additional background traffic volumes had negligible impact on the capacity analysis results and resulted in no reduction in LOS. Furthermore, Mr. Ben Tripp August 9, 2023 Page 2 \\Private\DFS\Projectdata\P2023\0453\A10\Traffic\Response To Comments\(00) 240 Deming RTC.DocxCorres. the attached traffic volumes, level of service and queue results should be considered conservative as they were completed assuming a larger development size of 72 units. 7. As part of the traffic study a dedicated right turn lane westbound on Deming St at Buckland Road should be evaluated to see if this would improve traffic flow westbound and eastbound on Deming Street. Residents have raised concerns about queue lengths on Deming Street westbound that are long enough so that eastbound traffic turning north has to wait for more than one cycle to get through the intersection at Buckland Road. I am open to suggestions to improve traffic flow at the intersection of Deming Street and Buckland Road. Response: The addition of a dedicated westbound right turn lane on Deming Street at the Buckland Street intersection was evaluated for impacts. The Synchro analysis revealed that the addition of a right turn lane would result in no improvement in approach LOS and negligible reductions in queue length on the approach (less than one vehicle length). The widening of Deming Street to provide a third approach lane is not warranted, independent of the additional traffic from this development. The combined (build) condition results with an added right turn lane are shown in the updated summary tables attached to this letter. Trip Generation Reduction for 55 Units Metro Realty has proposed to reduce the number of apartment units from 72 to 55 units. The expected site generated traffic data for this fewer number of units was recalculated using existing empirical data from the Institute of Transportation Engineers (ITE) publication Trip Generation, 11th edition, 2021. Trip generation for the weekday morning, weekday afternoon, and Saturday peak hour was calculated using the ITE land use code 221, “Multifamily Housing (Mid-Rise)". A 55 dwelling unit development is expected to generate a total of 20 trips (5 entering, 15 exiting) in the weekday morning peak hour, 21 trips (13 entering, 8 exiting) in the weekday afternoon peak hour, and 21 trips (11 entering, 10 exiting) in the Saturday peak hour. A summary of the peak hour trip generation information for the proposed development is provided in Table 1 below. Additionally, Table 1 includes the trip generation rates for the originally proposed 72 unit development. In comparison to the 72 unit development, the 55 unit development will result in a total of 5 fewer trips (2 fewer entering, 3 fewer exiting) during the morning peak hour, a total of 7 fewer trips (4 fewer entering, 3 fewer exiting) during the afternoon peak hour, and a total of 7 fewer trips (3 fewer entering, 4 fewer exiting) during the Saturday peak hour. Mr. Ben Tripp August 9, 2023 Page 3 \\Private\DFS\Projectdata\P2023\0453\A10\Traffic\Response To Comments\(00) 240 Deming RTC.DocxCorres. Table 1 Peak Hour Site Generated Traffic Volumes Proposed 240 Deming Street Residences South Windsor, Connecticut 55 Dwelling Units Total Trips Trips Entering Trips Exiting Morning Weekday Peak Hour 20 5 15 Afternoon Weekday Peak Hour 21 13 8 Saturday Peak Hour 21 11 10 72 Dwelling Units Morning Weekday Peak Hour 25 7 18 Afternoon Weekday Peak Hour 28 17 11 Saturday Peak Hour 28 14 14 Difference in Trip Generation Morning Weekday Peak Hour -5 -2 -3 Afternoon Weekday Peak Hour -7 -4 -3 Saturday Peak Hour -7 -3 -4 Note: Trip generation based on Rate per Land use Code 221 (Multifamily Housing (Mid-rise)), as published in Trip Generation, 11th Edition, 2021. With a reduction in the number of proposed units and the reduction of anticipated site generated traffic, the conclusion of the previously prepared traffic impact study that the proposed development will have no significant impact to the traffic operations within the study area is still valid. The lower number of trips generated will serve to further reduce the already de minimis impacts the larger 72 unit development would have produced. We trust this information will be sufficient for your review. If you have any questions or require additional information, please contact us at 86-646-2469. Sincerely, Reviewed By, Tyler Rudolph, PE Mark Vertucci, PE, PTOE Transportation Engineer Vice President DEMING STREETBUCKLAND ROAD240 DEMING STREET DEVELOPMENT SITE DRIVEWAYXX(XX)[XX] = WEEKDAY MORNING PEAK HOUR (WEEKDAY PM PEAK HOUR) [SATURDAY PEAK HOUR] 146 HARTFORD ROAD MANCHESTER, CONNECTICUT 06040 860.646.2469 www.fando.com FIGURE 2: 2025 BASELINE TRAFFIC VOLUMES File Path: J:\DWG\P2023\0453\A10\Civil\Plan\RTC\20230453A10_TVF01.dwg Layout: FIG 2. 2025 BASELINE Plotted: Mon, July 10, 2023 - 1:54 PM User: TYLER RUDOLPHJULY 2023PROJ. NO: 20230453.A10 240 DEMING STREET - SOUTH WINSOR, CT XX(XX)[XX] = WEEKDAY MORNING PEAK HOUR (WEEKDAY PM PEAK HOUR) [SATURDAY PEAK HOUR] DEMING STREETBUCKLAND ROAD240 DEMING STREET DEVELOPMENT SITE DRIVEWAY146 HARTFORD ROAD MANCHESTER, CONNECTICUT 06040 860.646.2469 www.fando.com FIGURE 3: OTHER GENERATORS - EVERGREEN WALK File Path: J:\DWG\P2023\0453\A10\Civil\Plan\RTC\20230453A10_TVF01.dwg Layout: FIG 3. OTHER GEN - EVERGREEN Plotted: Mon, July 10, 2023 - 1:54 PM User: TYLER RUDOLPHJULY 2023PROJ. NO: 20230453.A10 240 DEMING STREET - SOUTH WINDSOR, CT XX(XX)[XX] = WEEKDAY MORNING PEAK HOUR (WEEKDAY PM PEAK HOUR) [SATURDAY PEAK HOUR] DEMING STREETBUCKLAND ROAD240 DEMING STREET DEVELOPMENT SITE DRIVEWAY146 HARTFORD ROAD MANCHESTER, CONNECTICUT 06040 860.646.2469 www.fando.com FIGURE 4: OTHER GENERATORS - GATEWAY File Path: J:\DWG\P2023\0453\A10\Civil\Plan\RTC\20230453A10_TVF01.dwg Layout: FIG 4. OTHER GEN - GATEWAY Plotted: Thu, August 10, 2023 - 9:09 AM User: JOSUE FLORESJULY 2023PROJ. NO: 20230453.A10 240 DEMING STREET - SOUTH WINDSOR, CT XX(XX)[XX] = WEEKDAY MORNING PEAK HOUR (WEEKDAY PM PEAK HOUR) [SATURDAY PEAK HOUR] DEMING STREETBUCKLAND ROAD240 DEMING STREET DEVELOPMENT SITE DRIVEWAY146 HARTFORD ROAD MANCHESTER, CONNECTICUT 06040 860.646.2469 www.fando.com FIGURE 5: 2025 BACKGROUND TRAFFIC VOLUMES File Path: J:\DWG\P2023\0453\A10\Civil\Plan\RTC\20230453A10_TVF01.dwg Layout: FIG 5. 2025 BACKGROUND Plotted: Mon, July 10, 2023 - 1:54 PM User: TYLER RUDOLPHJULY 2023PROJ. NO: 20230453.A10 240 DEMING STREET - SOUTH WINDSOR, CT XX(XX) = ENTERING TRAFFIC (EXITING TRAFFIC) DEMING STREETBUCKLAND ROAD240 DEMING STREET DEVELOPMENT SITE DRIVEWAY146 HARTFORD ROAD MANCHESTER, CONNECTICUT 06040 860.646.2469 www.fando.com FIGURE 6: TRIP DISTRIBUTION File Path: J:\DWG\P2023\0453\A10\Civil\Plan\RTC\20230453A10_TVF01.dwg Layout: FIG 6. TRIP DIST Plotted: Mon, July 10, 2023 - 1:54 PM User: TYLER RUDOLPHJULY 2023PROJ. NO: 20230453.A10 240 DEMING STREET - SOUTH WINDSOR, CT XX(XX)[XX] = WEEKDAY MORNING PEAK HOUR (WEEKDAY PM PEAK HOUR) [SATURDAY PEAK HOUR] SITE GENERATED TRAFFIC VOLUMES ENTER EXIT TOTAL MORNING AFTERNOON DEMING STREETBUCKLAND ROAD240 DEMING STREET DEVELOPMENT SITE DRIVEWAY146 HARTFORD ROAD MANCHESTER, CONNECTICUT 06040 860.646.2469 www.fando.com FIGURE 7: TRIP GENERATION File Path: J:\DWG\P2023\0453\A10\Civil\Plan\RTC\20230453A10_TVF01.dwg Layout: FIG 7. TRIP GEN Plotted: Mon, July 10, 2023 - 1:54 PM User: TYLER RUDOLPHJULY 2023PROJ. NO: 20230453.A10 240 DEMING STREET - SOUTH WINDSOR, CT XX(XX) = WEEKDAY MORNING PEAK HOUR (WEEKDAY PM PEAK HOUR) [SATURDAY PEAK HOUR] DEMING STREETBUCKLAND ROAD240 DEMING STREET DEVELOPMENT SITE DRIVEWAY146 HARTFORD ROAD MANCHESTER, CONNECTICUT 06040 860.646.2469 www.fando.com FIGURE 8: 2025 COMBINED TRAFFIC VOLUMES File Path: J:\DWG\P2023\0453\A10\Civil\Plan\RTC\20230453A10_TVF01.dwg Layout: FIG 8. 2025 COMBINED Plotted: Mon, July 10, 2023 - 1:54 PM User: TYLER RUDOLPHJULY 2023PROJ. NO: 20230453.A10 240 DEMING STREET - SOUTH WINDSOR, CT Table 2 Unsignalized Intersection Level Of Service Summary 240 Deming Street South Windsor, CT Unsignalized Intersection (Critical Movements) 2025 Weekday Morning Peak Hour 2025 Weekday Afternoon Peak Hour 2025 Saturday Peak Hour Background Combined Background Combined Background Combined Deming Street and the Site Access Driveway Eastbound Deming Street Left LOS A* LOS A LOS A LOS A LOS A LOS A Southbound Driveway Left N/A LOS A N/A LOS A N/A LOS B Southbound Driveway Right N/A LOS A N/A LOS A N/A LOS B *Values indicated are critical movement Level of Service (LOS) Table 3 Signalized Intersection Level of Service Summary 240 Deming Street South Windsor, CT Signalized Intersections 2025 Weekday Morning Peak Hour 2025 Weekday Afternoon Peak Hour 2025 Saturday Peak Hour Background Combined Improved** Background Combined Improved** Background Combined Improved** Buckland Road and Deming Street 0.40/LOS B* 0.41/LOS B 0.40/LOS B 0.63/LOS C 0.63/LOS C 0.63/LOS C 0.55/LOS C 0.55/LOS C 0.56/LOS C *Values indicated are intersection v/c Ratio/LOS **Improved condition denotes results with the addition of a westbound right turn lane Table 4 Weekday Morning Peak Hour Queue Length Summary 240 Deming Street South Windsor, CT Intersection Approach Lane 2025 Background Queue 2025 Combined Queue 2025 Combined Improved Queue** Available Storage Buckland Road and Deming Street EB Left EB Through EB Right WB Left WB Through/Right WB Right NB Left NB Through/Right SB Left SB Through/Right 35 Feet 35 Feet 0 Feet 35 Feet 55 Feet N/A 25 Feet 95 Feet 10 Feet 165 Feet 35 Feet 35 Feet 0 Feet 40 Feet 55 Feet N/A 25 Feet 95 Feet 10 Feet 165 Feet 35 Feet 35 Feet 0 Feet 35 Feet 50 Feet 0 Feet 25 Feet 95 Feet 10 Feet 170 Feet 150 Feet - 385 Feet 130 Feet - 100 Feet 150 Feet - 300 Feet - Deming Street and the Site Access Driveway EB Through/Left SB Left/Right N/A N/A 0 Feet 5 Feet N/A N/A - - NOTE: Values indicated represent 95th percentile (design) vehicle queue lengths. Values are rounded to the nearest 5 feet. **Improved condition denotes results with the addition of a westbound right turn lane Table 5 Weekday Afternoon Peak Hour Queue Length Summary 240 Deming Street South Windsor, CT Intersection Approach Lane 2025 Background Queue 2025 Combined Queue 2025 Combined Improved Queue** Available Storage Buckland Road and Deming Street EB Left EB Through EB Right WB Left WB Through/Right WB Right NB Left NB Through/Right SB Left SB Through/Right 100 Feet 70 Feet 35 Feet 50 Feet 70 Feet N/A 35 Feet 245 Feet 20 Feet 315 Feet 100 Feet 75 Feet 35 Feet 55 Feet 75 Feet N/A 35 Feet 245 Feet 20 Feet 315 Feet 95 Feet 75 Feet 35 Feet 55 Feet 60 Feet 0 Feet 35 Feet 245 Feet 20 Feet 315 Feet 150 Feet - 385 Feet 130 Feet - 100 Feet 150 Feet - 300 Feet - Deming Street and the Site Access Driveway EB Through/Left SB Left/Right N/A N/A 0 Feet 0 Feet N/A N/A - - NOTE: Values indicated represent 95th percentile (design) vehicle queue lengths. Values are rounded to the nearest 5 feet. **Improved condition denotes results with the addition of a westbound right turn lane Table 6 Saturday Peak Hour Queue Length Summary 240 Deming Street South Windsor, CT Intersection Approach Lane 2025 Background Queue 2025 Combined Queue 2025 Combined Improved Queue** Available Storage Buckland Road and Deming Street EB Left EB Through EB Right WB Left WB Through/Right WB Right NB Left NB Through/Right SB Left SB Through/Right 80 Feet 75 Feet 10 Feet 70 Feet 80 Feet N/A 30 Feet 185 Feet 20 Feet 280 Feet 80 Feet 75 Feet 10 Feet 75 Feet 85 Feet N/A 30 Feet 185 Feet 20 Feet 280 Feet 75 Feet 75 Feet 10 Feet 75 Feet 65 Feet 0 Feet 30 Feet 185 Feet 20 Feet 280 Feet 150 Feet - 385 Feet 130 Feet - 100 Feet 150 Feet - 300 Feet - Deming Street and the Site Access Driveway EB Through/Left SB Left/Right N/A N/A 0 Feet 5 Feet N/A N/A - - NOTE: Values indicated represent 95th percentile (design) vehicle queue lengths. Values are rounded to the nearest 5 feet. **Improved condition denotes results with the addition of a westbound right turn lane Lanes, Volumes, Timings 240 Deming Street 1: Deming Street & Buckland Road 2025 AM Background Fuss & O'Neill - JJF Synchro 11 Report F:\P2023\0453\A10\Traffic\Synchro\2025 AM Background.syn Page 1 Lane Group EBL EBT EBR WBL WBT WBR NBL NBT NBR SBL SBT SBR Lane Configurations Traffic Volume (vph) 42 40 91 36 63 27 90 432 31 20 604 65 Future Volume (vph) 42 40 91 36 63 27 90 432 31 20 604 65 Ideal Flow (vphpl) 1900 1900 1900 1900 1900 1900 1900 1900 1900 1900 1900 1900 Storage Length (ft) 150 0 130 0 150 0 300 0 Storage Lanes 1 1 1 0 1 0 1 0 Taper Length (ft) 25 25 25 25 Lane Util. Factor 1.00 1.00 1.00 1.00 1.00 1.00 1.00 0.95 0.95 1.00 0.95 0.95 Frt 0.850 0.955 0.990 0.985 Flt Protected 0.950 0.950 0.950 0.950 Satd. Flow (prot) 1770 1863 1583 1770 1779 0 1770 3504 0 1770 3486 0 Flt Permitted 0.694 0.729 0.248 0.467 Satd. Flow (perm) 1293 1863 1583 1358 1779 0 462 3504 0 870 3486 0 Right Turn on Red Yes Yes Yes Yes Satd. Flow (RTOR) 204 29 14 19 Link Speed (mph) 30 30 30 30 Link Distance (ft) 293 311 564 246 Travel Time (s) 6.7 7.1 12.8 5.6 Peak Hour Factor 0.92 0.92 0.92 0.92 0.92 0.92 0.92 0.92 0.92 0.92 0.92 0.92 Adj. Flow (vph) 46 43 99 39 68 29 98 470 34 22 657 71 Shared Lane Traffic (%) Lane Group Flow (vph) 46 43 99 39 97 0 98 504 0 22 728 0 Turn Type Perm NA Perm Perm NA pm+pt NA pm+pt NA Protected Phases 4 4 5 2 1 6 Permitted Phases 4 4 4 2 6 Detector Phase 4 4 4 4 4 5 2 1 6 Switch Phase Minimum Initial (s) 9.0 9.0 9.0 9.0 9.0 15.0 15.0 10.0 15.0 Minimum Split (s) 23.0 23.0 23.0 23.0 23.0 19.0 24.2 14.0 24.2 Total Split (s) 21.0 21.0 21.0 21.0 21.0 17.0 27.0 12.0 22.0 Total Split (%) 35.0% 35.0% 35.0% 35.0% 35.0% 28.3% 45.0% 20.0% 36.7% Maximum Green (s) 16.0 16.0 16.0 16.0 16.0 13.0 20.8 8.0 15.8 Yellow Time (s) 3.0 3.0 3.0 3.0 3.0 3.0 4.2 3.0 4.2 All-Red Time (s) 2.0 2.0 2.0 2.0 2.0 1.0 2.0 1.0 2.0 Lost Time Adjust (s) 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 Total Lost Time (s) 5.0 5.0 5.0 5.0 5.0 4.0 6.2 4.0 6.2 Lead/Lag Lead Lag Lead Lag Lead-Lag Optimize?Yes Yes Yes Yes Vehicle Extension (s) 3.0 3.0 3.0 3.0 3.0 3.0 3.0 3.0 3.0 Recall Mode None None None None None Min Max Min Max Walk Time (s) 7.0 7.0 7.0 7.0 7.0 7.0 7.0 Flash Dont Walk (s) 11.0 11.0 11.0 11.0 11.0 11.0 11.0 Pedestrian Calls (#/hr) 0 0 0 0 0 0 0 Act Effct Green (s) 9.9 9.9 9.9 9.9 9.9 37.8 23.4 28.7 18.3 Actuated g/C Ratio 0.19 0.19 0.19 0.19 0.19 0.71 0.44 0.54 0.34 v/c Ratio 0.19 0.12 0.21 0.15 0.27 0.15 0.33 0.04 0.60 Control Delay 21.8 20.2 1.1 21.1 17.2 4.2 11.5 4.5 17.9 Queue Delay 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 Total Delay 21.8 20.2 1.1 21.1 17.2 4.2 11.5 4.5 17.9 Lanes, Volumes, Timings 240 Deming Street 1: Deming Street & Buckland Road 2025 AM Background Fuss & O'Neill - JJF Synchro 11 Report F:\P2023\0453\A10\Traffic\Synchro\2025 AM Background.syn Page 2 Lane Group EBL EBT EBR WBL WBT WBR NBL NBT NBR SBL SBT SBR LOS C C A C B A B A B Approach Delay 10.5 18.3 10.3 17.5 Approach LOS B B B B Queue Length 50th (ft) 13 12 0 11 20 9 54 2 101 Queue Length 95th (ft) 37 34 0 32 54 25 95 8 166 Internal Link Dist (ft) 213 231 484 166 Turn Bay Length (ft) 150 130 150 300 Base Capacity (vph) 394 568 624 414 563 652 1545 605 1209 Starvation Cap Reductn 0 0 0 0 0 0 0 0 0 Spillback Cap Reductn 0 0 0 0 0 0 0 0 0 Storage Cap Reductn 0 0 0 0 0 0 0 0 0 Reduced v/c Ratio 0.12 0.08 0.16 0.09 0.17 0.15 0.33 0.04 0.60 Intersection Summary Area Type: Other Cycle Length: 60 Actuated Cycle Length: 53.3 Natural Cycle: 70 Control Type: Actuated-Uncoordinated Maximum v/c Ratio: 0.60 Intersection Signal Delay: 14.2 Intersection LOS: B Intersection Capacity Utilization 52.9% ICU Level of Service A Analysis Period (min) 15 Splits and Phases: 1: Deming Street & Buckland Road HCM Signalized Intersection Capacity Analysis 240 Deming Street 1: Deming Street & Buckland Road 2025 AM Background Fuss & O'Neill - JJF Synchro 11 Report F:\P2023\0453\A10\Traffic\Synchro\2025 AM Background.syn Page 3 Movement EBL EBT EBR WBL WBT WBR NBL NBT NBR SBL SBT SBR Lane Configurations Traffic Volume (vph) 42 40 91 36 63 27 90 432 31 20 604 65 Future Volume (vph) 42 40 91 36 63 27 90 432 31 20 604 65 Ideal Flow (vphpl) 1900 1900 1900 1900 1900 1900 1900 1900 1900 1900 1900 1900 Total Lost time (s) 5.0 5.0 5.0 5.0 5.0 4.0 6.2 4.0 6.2 Lane Util. Factor 1.00 1.00 1.00 1.00 1.00 1.00 0.95 1.00 0.95 Frt 1.00 1.00 0.85 1.00 0.96 1.00 0.99 1.00 0.99 Flt Protected 0.95 1.00 1.00 0.95 1.00 0.95 1.00 0.95 1.00 Satd. Flow (prot) 1770 1863 1583 1770 1779 1770 3503 1770 3487 Flt Permitted 0.69 1.00 1.00 0.73 1.00 0.25 1.00 0.47 1.00 Satd. Flow (perm) 1293 1863 1583 1358 1779 463 3503 870 3487 Peak-hour factor, PHF 0.92 0.92 0.92 0.92 0.92 0.92 0.92 0.92 0.92 0.92 0.92 0.92 Adj. Flow (vph) 46 43 99 39 68 29 98 470 34 22 657 71 RTOR Reduction (vph) 0 0 85 0 25 0 0 8 0 0 13 0 Lane Group Flow (vph) 46 43 14 39 72 0 98 496 0 22 715 0 Turn Type Perm NA Perm Perm NA pm+pt NA pm+pt NA Protected Phases 4 4 5 2 1 6 Permitted Phases 4 4 4 2 6 Actuated Green, G (s) 7.6 7.6 7.6 7.6 7.6 35.5 23.4 26.4 18.3 Effective Green, g (s) 7.6 7.6 7.6 7.6 7.6 35.5 23.4 26.4 18.3 Actuated g/C Ratio 0.14 0.14 0.14 0.14 0.14 0.65 0.43 0.49 0.34 Clearance Time (s) 5.0 5.0 5.0 5.0 5.0 4.0 6.2 4.0 6.2 Vehicle Extension (s) 3.0 3.0 3.0 3.0 3.0 3.0 3.0 3.0 3.0 Lane Grp Cap (vph) 180 260 221 190 248 620 1509 557 1175 v/s Ratio Prot 0.02 c0.04 c0.04 c0.14 0.01 c0.21 v/s Ratio Perm 0.04 0.01 0.03 0.06 0.01 v/c Ratio 0.26 0.17 0.06 0.21 0.29 0.16 0.33 0.04 0.61 Uniform Delay, d1 20.8 20.6 20.3 20.7 20.9 4.1 10.2 7.3 15.0 Progression Factor 1.00 1.00 1.00 1.00 1.00 1.00 1.00 1.00 1.00 Incremental Delay, d2 0.8 0.3 0.1 0.5 0.7 0.1 0.6 0.0 2.4 Delay (s) 21.6 20.9 20.4 21.2 21.6 4.2 10.8 7.3 17.4 Level of Service C C C C C A B A B Approach Delay (s) 20.8 21.5 9.7 17.1 Approach LOS C C A B Intersection Summary HCM 2000 Control Delay 15.2 HCM 2000 Level of Service B HCM 2000 Volume to Capacity ratio 0.40 Actuated Cycle Length (s) 54.3 Sum of lost time (s) 15.2 Intersection Capacity Utilization 52.9% ICU Level of Service A Analysis Period (min) 15 c Critical Lane Group Lanes, Volumes, Timings 240 Deming Street 1: Deming Street & Buckland Road 2025 AM Combined Fuss & O'Neill - JFF Synchro 11 Report F:\P2023\0453\A10\Traffic\Synchro\2025 AM Combined.syn Page 1 Lane Group EBL EBT EBR WBL WBT WBR NBL NBT NBR SBL SBT SBR Lane Configurations Traffic Volume (vph) 42 41 91 43 66 32 90 432 34 22 604 65 Future Volume (vph) 42 41 91 43 66 32 90 432 34 22 604 65 Ideal Flow (vphpl) 1900 1900 1900 1900 1900 1900 1900 1900 1900 1900 1900 1900 Storage Length (ft) 150 0 130 0 150 0 300 0 Storage Lanes 1 1 1 0 1 0 1 0 Taper Length (ft) 25 25 25 25 Lane Util. Factor 1.00 1.00 1.00 1.00 1.00 1.00 1.00 0.95 0.95 1.00 0.95 0.95 Frt 0.850 0.951 0.989 0.985 Flt Protected 0.950 0.950 0.950 0.950 Satd. Flow (prot) 1770 1863 1583 1770 1771 0 1770 3500 0 1770 3486 0 Flt Permitted 0.688 0.728 0.248 0.465 Satd. Flow (perm) 1282 1863 1583 1356 1771 0 462 3500 0 866 3486 0 Right Turn on Red Yes Yes Yes Yes Satd. Flow (RTOR) 204 35 15 19 Link Speed (mph) 30 30 30 30 Link Distance (ft) 243 625 564 263 Travel Time (s) 5.5 14.2 12.8 6.0 Peak Hour Factor 0.92 0.92 0.92 0.92 0.92 0.92 0.92 0.92 0.92 0.92 0.92 0.92 Adj. Flow (vph) 46 45 99 47 72 35 98 470 37 24 657 71 Shared Lane Traffic (%) Lane Group Flow (vph) 46 45 99 47 107 0 98 507 0 24 728 0 Turn Type Perm NA Perm Perm NA pm+pt NA pm+pt NA Protected Phases 4 4 5 2 1 6 Permitted Phases 4 4 4 2 6 Detector Phase 4 4 4 4 4 5 2 1 6 Switch Phase Minimum Initial (s) 9.0 9.0 9.0 9.0 9.0 15.0 15.0 10.0 15.0 Minimum Split (s) 23.0 23.0 23.0 23.0 23.0 19.0 24.2 14.0 24.2 Total Split (s) 21.0 21.0 21.0 21.0 21.0 17.0 27.0 12.0 22.0 Total Split (%) 35.0% 35.0% 35.0% 35.0% 35.0% 28.3% 45.0% 20.0% 36.7% Maximum Green (s) 16.0 16.0 16.0 16.0 16.0 13.0 20.8 8.0 15.8 Yellow Time (s) 3.0 3.0 3.0 3.0 3.0 3.0 4.2 3.0 4.2 All-Red Time (s) 2.0 2.0 2.0 2.0 2.0 1.0 2.0 1.0 2.0 Lost Time Adjust (s) 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 Total Lost Time (s) 5.0 5.0 5.0 5.0 5.0 4.0 6.2 4.0 6.2 Lead/Lag Lead Lag Lead Lag Lead-Lag Optimize?Yes Yes Yes Yes Vehicle Extension (s) 3.0 3.0 3.0 3.0 3.0 3.0 3.0 3.0 3.0 Recall Mode None None None None None Min Max Min Max Walk Time (s) 7.0 7.0 7.0 7.0 7.0 7.0 7.0 Flash Dont Walk (s) 11.0 11.0 11.0 11.0 11.0 11.0 11.0 Pedestrian Calls (#/hr) 0 0 0 0 0 0 0 Act Effct Green (s) 10.0 10.0 10.0 10.0 10.0 37.8 23.4 28.7 18.3 Actuated g/C Ratio 0.19 0.19 0.19 0.19 0.19 0.71 0.44 0.54 0.34 v/c Ratio 0.19 0.13 0.21 0.19 0.30 0.15 0.33 0.04 0.60 Control Delay 21.7 20.2 1.1 21.5 16.9 4.3 11.6 4.5 18.0 Queue Delay 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 Total Delay 21.7 20.2 1.1 21.5 16.9 4.3 11.6 4.5 18.0 Lanes, Volumes, Timings 240 Deming Street 1: Deming Street & Buckland Road 2025 AM Combined Fuss & O'Neill - JFF Synchro 11 Report F:\P2023\0453\A10\Traffic\Synchro\2025 AM Combined.syn Page 2 Lane Group EBL EBT EBR WBL WBT WBR NBL NBT NBR SBL SBT SBR LOS C C A C B A B A B Approach Delay 10.6 18.3 10.4 17.5 Approach LOS B B B B Queue Length 50th (ft) 13 13 0 14 21 9 54 2 101 Queue Length 95th (ft) 37 35 0 37 56 25 96 9 167 Internal Link Dist (ft) 163 545 484 183 Turn Bay Length (ft) 150 130 150 300 Base Capacity (vph) 390 568 624 413 564 651 1542 603 1207 Starvation Cap Reductn 0 0 0 0 0 0 0 0 0 Spillback Cap Reductn 0 0 0 0 0 0 0 0 0 Storage Cap Reductn 0 0 0 0 0 0 0 0 0 Reduced v/c Ratio 0.12 0.08 0.16 0.11 0.19 0.15 0.33 0.04 0.60 Intersection Summary Area Type: Other Cycle Length: 60 Actuated Cycle Length: 53.4 Natural Cycle: 70 Control Type: Actuated-Uncoordinated Maximum v/c Ratio: 0.60 Intersection Signal Delay: 14.3 Intersection LOS: B Intersection Capacity Utilization 53.0% ICU Level of Service A Analysis Period (min) 15 Splits and Phases: 1: Deming Street & Buckland Road HCM Signalized Intersection Capacity Analysis 240 Deming Street 1: Deming Street & Buckland Road 2025 AM Combined Fuss & O'Neill - JFF Synchro 11 Report F:\P2023\0453\A10\Traffic\Synchro\2025 AM Combined.syn Page 3 Movement EBL EBT EBR WBL WBT WBR NBL NBT NBR SBL SBT SBR Lane Configurations Traffic Volume (vph) 42 41 91 43 66 32 90 432 34 22 604 65 Future Volume (vph) 42 41 91 43 66 32 90 432 34 22 604 65 Ideal Flow (vphpl) 1900 1900 1900 1900 1900 1900 1900 1900 1900 1900 1900 1900 Total Lost time (s) 5.0 5.0 5.0 5.0 5.0 4.0 6.2 4.0 6.2 Lane Util. Factor 1.00 1.00 1.00 1.00 1.00 1.00 0.95 1.00 0.95 Frt 1.00 1.00 0.85 1.00 0.95 1.00 0.99 1.00 0.99 Flt Protected 0.95 1.00 1.00 0.95 1.00 0.95 1.00 0.95 1.00 Satd. Flow (prot) 1770 1863 1583 1770 1771 1770 3500 1770 3487 Flt Permitted 0.69 1.00 1.00 0.73 1.00 0.25 1.00 0.47 1.00 Satd. Flow (perm) 1281 1863 1583 1356 1771 462 3500 867 3487 Peak-hour factor, PHF 0.92 0.92 0.92 0.92 0.92 0.92 0.92 0.92 0.92 0.92 0.92 0.92 Adj. Flow (vph) 46 45 99 47 72 35 98 470 37 24 657 71 RTOR Reduction (vph) 0 0 85 0 30 0 0 9 0 0 13 0 Lane Group Flow (vph) 46 45 14 47 77 0 98 498 0 24 715 0 Turn Type Perm NA Perm Perm NA pm+pt NA pm+pt NA Protected Phases 4 4 5 2 1 6 Permitted Phases 4 4 4 2 6 Actuated Green, G (s) 7.7 7.7 7.7 7.7 7.7 35.5 23.4 26.4 18.3 Effective Green, g (s) 7.7 7.7 7.7 7.7 7.7 35.5 23.4 26.4 18.3 Actuated g/C Ratio 0.14 0.14 0.14 0.14 0.14 0.65 0.43 0.49 0.34 Clearance Time (s) 5.0 5.0 5.0 5.0 5.0 4.0 6.2 4.0 6.2 Vehicle Extension (s) 3.0 3.0 3.0 3.0 3.0 3.0 3.0 3.0 3.0 Lane Grp Cap (vph) 181 263 224 191 250 618 1505 555 1173 v/s Ratio Prot 0.02 c0.04 c0.04 c0.14 0.01 c0.21 v/s Ratio Perm 0.04 0.01 0.03 0.06 0.01 v/c Ratio 0.25 0.17 0.06 0.25 0.31 0.16 0.33 0.04 0.61 Uniform Delay, d1 20.8 20.5 20.2 20.8 21.0 4.1 10.3 7.3 15.1 Progression Factor 1.00 1.00 1.00 1.00 1.00 1.00 1.00 1.00 1.00 Incremental Delay, d2 0.7 0.3 0.1 0.7 0.7 0.1 0.6 0.0 2.4 Delay (s) 21.5 20.9 20.3 21.4 21.7 4.2 10.9 7.3 17.4 Level of Service C C C C C A B A B Approach Delay (s) 20.8 21.6 9.8 17.1 Approach LOS C C A B Intersection Summary HCM 2000 Control Delay 15.3 HCM 2000 Level of Service B HCM 2000 Volume to Capacity ratio 0.41 Actuated Cycle Length (s) 54.4 Sum of lost time (s) 15.2 Intersection Capacity Utilization 53.0% ICU Level of Service A Analysis Period (min) 15 c Critical Lane Group Lanes, Volumes, Timings 240 Deming Street 2: Deming Street & Site Driveway 2025 AM Combined Fuss & O'Neill - JFF Synchro 11 Report F:\P2023\0453\A10\Traffic\Synchro\2025 AM Combined.syn Page 4 Lane Group EBL EBT WBT WBR SBL SBR Lane Configurations Traffic Volume (vph) 6 91 126 1 3 15 Future Volume (vph) 6 91 126 1 3 15 Ideal Flow (vphpl) 1900 1900 1900 1900 1900 1900 Lane Util. Factor 1.00 1.00 1.00 1.00 1.00 1.00 Frt 0.999 0.886 Flt Protected 0.997 0.992 Satd. Flow (prot) 0 1857 1861 0 1637 0 Flt Permitted 0.997 0.992 Satd. Flow (perm) 0 1857 1861 0 1637 0 Link Speed (mph) 30 30 30 Link Distance (ft) 625 300 155 Travel Time (s) 14.2 6.8 3.5 Peak Hour Factor 0.92 0.92 0.92 0.92 0.92 0.92 Adj. Flow (vph) 7 99 137 1 3 16 Shared Lane Traffic (%) Lane Group Flow (vph) 0 106 138 0 19 0 Sign Control Free Free Stop Intersection Summary Area Type: Other Control Type: Unsignalized Intersection Capacity Utilization 19.7% ICU Level of Service A Analysis Period (min) 15 HCM Unsignalized Intersection Capacity Analysis 240 Deming Street 2: Deming Street & Site Driveway 2025 AM Combined Fuss & O'Neill - JFF Synchro 11 Report F:\P2023\0453\A10\Traffic\Synchro\2025 AM Combined.syn Page 5 Movement EBL EBT WBT WBR SBL SBR Lane Configurations Traffic Volume (veh/h) 6 91 126 1 3 15 Future Volume (Veh/h) 6 91 126 1 3 15 Sign Control Free Free Stop Grade 0% 0% 0% Peak Hour Factor 0.92 0.92 0.92 0.92 0.92 0.92 Hourly flow rate (vph) 7 99 137 1 3 16 Pedestrians Lane Width (ft) Walking Speed (ft/s) Percent Blockage Right turn flare (veh) Median type None None Median storage veh) Upstream signal (ft) 625 pX, platoon unblocked vC, conflicting volume 138 250 138 vC1, stage 1 conf vol vC2, stage 2 conf vol vCu, unblocked vol 138 250 138 tC, single (s) 4.1 6.4 6.2 tC, 2 stage (s) tF (s) 2.2 3.5 3.3 p0 queue free % 100 100 98 cM capacity (veh/h) 1446 734 911 Direction, Lane # EB 1 WB 1 SB 1 Volume Total 106 138 19 Volume Left 7 0 3 Volume Right 0 1 16 cSH 1446 1700 878 Volume to Capacity 0.00 0.08 0.02 Queue Length 95th (ft) 0 0 2 Control Delay (s) 0.5 0.0 9.2 Lane LOS A A Approach Delay (s) 0.5 0.0 9.2 Approach LOS A Intersection Summary Average Delay 0.9 Intersection Capacity Utilization 19.7% ICU Level of Service A Analysis Period (min) 15 Lanes, Volumes, Timings 240 Deming Street 1: Deming Street & Buckland Road 2025 AM Combined Improved Fuss & O'Neill - JFF Synchro 11 Report F:\P2023\0453\A10\Traffic\Synchro\2025 AM Combined Improved.syn Page 1 Lane Group EBL EBT EBR WBL WBT WBR NBL NBT NBR SBL SBT SBR Lane Configurations Traffic Volume (vph) 42 41 91 43 66 32 90 432 34 22 604 65 Future Volume (vph) 42 41 91 43 66 32 90 432 34 22 604 65 Ideal Flow (vphpl) 1900 1900 1900 1900 1900 1900 1900 1900 1900 1900 1900 1900 Storage Length (ft) 150 0 130 100 150 0 300 0 Storage Lanes 1 1 1 1 1 0 1 0 Taper Length (ft) 25 25 25 25 Lane Util. Factor 1.00 1.00 1.00 1.00 1.00 1.00 1.00 0.95 0.95 1.00 0.95 0.95 Frt 0.850 0.850 0.989 0.985 Flt Protected 0.950 0.950 0.950 0.950 Satd. Flow (prot) 1770 1863 1583 1770 1863 1583 1770 3500 0 1770 3486 0 Flt Permitted 0.710 0.728 0.248 0.465 Satd. Flow (perm) 1323 1863 1583 1356 1863 1583 462 3500 0 866 3486 0 Right Turn on Red Yes Yes Yes Yes Satd. Flow (RTOR) 204 204 15 19 Link Speed (mph) 30 30 30 30 Link Distance (ft) 243 625 564 263 Travel Time (s) 5.5 14.2 12.8 6.0 Peak Hour Factor 0.92 0.92 0.92 0.92 0.92 0.92 0.92 0.92 0.92 0.92 0.92 0.92 Adj. Flow (vph) 46 45 99 47 72 35 98 470 37 24 657 71 Shared Lane Traffic (%) Lane Group Flow (vph) 46 45 99 47 72 35 98 507 0 24 728 0 Turn Type Perm NA Perm Perm NA Perm pm+pt NA pm+pt NA Protected Phases 4 4 5 2 1 6 Permitted Phases 4 4 4 4 2 6 Detector Phase 4 4 4 4 4 4 5 2 1 6 Switch Phase Minimum Initial (s) 9.0 9.0 9.0 9.0 9.0 9.0 15.0 15.0 10.0 15.0 Minimum Split (s) 23.0 23.0 23.0 23.0 23.0 23.0 19.0 24.2 14.0 24.2 Total Split (s) 21.0 21.0 21.0 21.0 21.0 21.0 17.0 27.0 12.0 22.0 Total Split (%) 35.0% 35.0% 35.0% 35.0% 35.0% 35.0% 28.3% 45.0% 20.0% 36.7% Maximum Green (s) 16.0 16.0 16.0 16.0 16.0 16.0 13.0 20.8 8.0 15.8 Yellow Time (s) 3.0 3.0 3.0 3.0 3.0 3.0 3.0 4.2 3.0 4.2 All-Red Time (s) 2.0 2.0 2.0 2.0 2.0 2.0 1.0 2.0 1.0 2.0 Lost Time Adjust (s) 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 Total Lost Time (s) 5.0 5.0 5.0 5.0 5.0 5.0 4.0 6.2 4.0 6.2 Lead/Lag Lead Lag Lead Lag Lead-Lag Optimize?Yes Yes Yes Yes Vehicle Extension (s) 3.0 3.0 3.0 3.0 3.0 3.0 3.0 3.0 3.0 3.0 Recall Mode None None None None None None Min Max Min Max Walk Time (s) 7.0 7.0 7.0 7.0 7.0 7.0 7.0 7.0 Flash Dont Walk (s) 11.0 11.0 11.0 11.0 11.0 11.0 11.0 11.0 Pedestrian Calls (#/hr) 0 0 0 0 0 0 0 0 Act Effct Green (s) 9.9 9.9 9.9 9.9 9.9 9.9 37.8 23.4 28.7 18.3 Actuated g/C Ratio 0.19 0.19 0.19 0.19 0.19 0.19 0.71 0.44 0.54 0.34 v/c Ratio 0.19 0.13 0.21 0.19 0.21 0.08 0.15 0.33 0.04 0.60 Control Delay 21.6 20.3 1.1 21.6 21.3 0.3 4.2 11.5 4.5 17.9 Queue Delay 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 Total Delay 21.6 20.3 1.1 21.6 21.3 0.3 4.2 11.5 4.5 17.9 Lanes, Volumes, Timings 240 Deming Street 1: Deming Street & Buckland Road 2025 AM Combined Improved Fuss & O'Neill - JFF Synchro 11 Report F:\P2023\0453\A10\Traffic\Synchro\2025 AM Combined Improved.syn Page 2 Lane Group EBL EBT EBR WBL WBT WBR NBL NBT NBR SBL SBT SBR LOS C C A C C A A B A B Approach Delay 10.6 16.6 10.3 17.5 Approach LOS B B B B Queue Length 50th (ft) 13 13 0 14 21 0 9 54 2 101 Queue Length 95th (ft) 37 35 0 37 50 0 25 96 9 168 Internal Link Dist (ft) 163 545 484 183 Turn Bay Length (ft) 150 130 100 150 300 Base Capacity (vph) 403 568 624 414 568 624 652 1544 603 1209 Starvation Cap Reductn 0 0 0 0 0 0 0 0 0 0 Spillback Cap Reductn 0 0 0 0 0 0 0 0 0 0 Storage Cap Reductn 0 0 0 0 0 0 0 0 0 0 Reduced v/c Ratio 0.11 0.08 0.16 0.11 0.13 0.06 0.15 0.33 0.04 0.60 Intersection Summary Area Type: Other Cycle Length: 60 Actuated Cycle Length: 53.3 Natural Cycle: 70 Control Type: Actuated-Uncoordinated Maximum v/c Ratio: 0.60 Intersection Signal Delay: 14.1 Intersection LOS: B Intersection Capacity Utilization 53.0% ICU Level of Service A Analysis Period (min) 15 Splits and Phases: 1: Deming Street & Buckland Road HCM Signalized Intersection Capacity Analysis 240 Deming Street 1: Deming Street & Buckland Road 2025 AM Combined Improved Fuss & O'Neill - JFF Synchro 11 Report F:\P2023\0453\A10\Traffic\Synchro\2025 AM Combined Improved.syn Page 3 Movement EBL EBT EBR WBL WBT WBR NBL NBT NBR SBL SBT SBR Lane Configurations Traffic Volume (vph) 42 41 91 43 66 32 90 432 34 22 604 65 Future Volume (vph) 42 41 91 43 66 32 90 432 34 22 604 65 Ideal Flow (vphpl) 1900 1900 1900 1900 1900 1900 1900 1900 1900 1900 1900 1900 Total Lost time (s) 5.0 5.0 5.0 5.0 5.0 5.0 4.0 6.2 4.0 6.2 Lane Util. Factor 1.00 1.00 1.00 1.00 1.00 1.00 1.00 0.95 1.00 0.95 Frt 1.00 1.00 0.85 1.00 1.00 0.85 1.00 0.99 1.00 0.99 Flt Protected 0.95 1.00 1.00 0.95 1.00 1.00 0.95 1.00 0.95 1.00 Satd. Flow (prot) 1770 1863 1583 1770 1863 1583 1770 3500 1770 3487 Flt Permitted 0.71 1.00 1.00 0.73 1.00 1.00 0.25 1.00 0.47 1.00 Satd. Flow (perm) 1323 1863 1583 1356 1863 1583 463 3500 867 3487 Peak-hour factor, PHF 0.92 0.92 0.92 0.92 0.92 0.92 0.92 0.92 0.92 0.92 0.92 0.92 Adj. Flow (vph) 46 45 99 47 72 35 98 470 37 24 657 71 RTOR Reduction (vph) 0 0 85 0 0 30 0 9 0 0 13 0 Lane Group Flow (vph) 46 45 14 47 72 5 98 498 0 24 715 0 Turn Type Perm NA Perm Perm NA Perm pm+pt NA pm+pt NA Protected Phases 4 4 5 2 1 6 Permitted Phases 4 4 4 4 2 6 Actuated Green, G (s) 7.6 7.6 7.6 7.6 7.6 7.6 35.5 23.4 26.4 18.3 Effective Green, g (s) 7.6 7.6 7.6 7.6 7.6 7.6 35.5 23.4 26.4 18.3 Actuated g/C Ratio 0.14 0.14 0.14 0.14 0.14 0.14 0.65 0.43 0.49 0.34 Clearance Time (s) 5.0 5.0 5.0 5.0 5.0 5.0 4.0 6.2 4.0 6.2 Vehicle Extension (s) 3.0 3.0 3.0 3.0 3.0 3.0 3.0 3.0 3.0 3.0 Lane Grp Cap (vph) 185 260 221 189 260 221 620 1508 556 1175 v/s Ratio Prot 0.02 c0.04 c0.04 c0.14 0.01 c0.21 v/s Ratio Perm 0.03 0.01 0.03 0.00 0.06 0.01 v/c Ratio 0.25 0.17 0.06 0.25 0.28 0.02 0.16 0.33 0.04 0.61 Uniform Delay, d1 20.8 20.6 20.3 20.8 20.9 20.1 4.1 10.3 7.3 15.0 Progression Factor 1.00 1.00 1.00 1.00 1.00 1.00 1.00 1.00 1.00 1.00 Incremental Delay, d2 0.7 0.3 0.1 0.7 0.6 0.0 0.1 0.6 0.0 2.4 Delay (s) 21.5 20.9 20.4 21.5 21.5 20.2 4.2 10.8 7.3 17.4 Level of Service C C C C C C A B A B Approach Delay (s) 20.8 21.2 9.8 17.0 Approach LOS C C A B Intersection Summary HCM 2000 Control Delay 15.2 HCM 2000 Level of Service B HCM 2000 Volume to Capacity ratio 0.40 Actuated Cycle Length (s) 54.3 Sum of lost time (s) 15.2 Intersection Capacity Utilization 53.0% ICU Level of Service A Analysis Period (min) 15 c Critical Lane Group Lanes, Volumes, Timings 240 Deming Street 1: Deming Street & Buckland Road 2025 PM Background Fuss & O'Neill - JJF Synchro 11 Report F:\P2023\0453\A10\Traffic\Synchro\2025 PM Background.syn Page 1 Lane Group EBL EBT EBR WBL WBT WBR NBL NBT NBR SBL SBT SBR Lane Configurations Traffic Volume (vph) 138 106 170 65 86 40 109 867 77 51 817 103 Future Volume (vph) 138 106 170 65 86 40 109 867 77 51 817 103 Ideal Flow (vphpl) 1900 1900 1900 1900 1900 1900 1900 1900 1900 1900 1900 1900 Storage Length (ft) 150 0 130 0 150 0 300 0 Storage Lanes 1 1 1 0 1 0 1 0 Taper Length (ft) 25 25 25 25 Lane Util. Factor 1.00 1.00 1.00 1.00 1.00 1.00 1.00 0.95 0.95 1.00 0.95 0.95 Frt 0.850 0.953 0.988 0.983 Flt Protected 0.950 0.950 0.950 0.950 Satd. Flow (prot) 1770 1863 1583 1770 1775 0 1770 3497 0 1770 3479 0 Flt Permitted 0.670 0.683 0.181 0.221 Satd. Flow (perm) 1248 1863 1583 1272 1775 0 337 3497 0 412 3479 0 Right Turn on Red Yes Yes Yes Yes Satd. Flow (RTOR) 204 38 17 22 Link Speed (mph) 30 30 30 30 Link Distance (ft) 449 312 564 512 Travel Time (s) 10.2 7.1 12.8 11.6 Peak Hour Factor 0.92 0.92 0.92 0.92 0.92 0.92 0.92 0.92 0.92 0.92 0.92 0.92 Adj. Flow (vph) 150 115 185 71 93 43 118 942 84 55 888 112 Shared Lane Traffic (%) Lane Group Flow (vph) 150 115 185 71 136 0 118 1026 0 55 1000 0 Turn Type Perm NA Perm Perm NA pm+pt NA pm+pt NA Protected Phases 4 4 5 2 1 6 Permitted Phases 4 4 4 2 6 Detector Phase 4 4 4 4 4 5 2 1 6 Switch Phase Minimum Initial (s) 9.0 9.0 9.0 9.0 9.0 15.0 15.0 10.0 15.0 Minimum Split (s) 23.0 23.0 23.0 23.0 23.0 19.0 24.2 14.0 24.2 Total Split (s) 21.0 21.0 21.0 21.0 21.0 17.0 27.0 12.0 22.0 Total Split (%) 35.0% 35.0% 35.0% 35.0% 35.0% 28.3% 45.0% 20.0% 36.7% Maximum Green (s) 16.0 16.0 16.0 16.0 16.0 13.0 20.8 8.0 15.8 Yellow Time (s) 3.0 3.0 3.0 3.0 3.0 3.0 4.2 3.0 4.2 All-Red Time (s) 2.0 2.0 2.0 2.0 2.0 1.0 2.0 1.0 2.0 Lost Time Adjust (s) 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 Total Lost Time (s) 5.0 5.0 5.0 5.0 5.0 4.0 6.2 4.0 6.2 Lead/Lag Lead Lag Lead Lag Lead-Lag Optimize?Yes Yes Yes Yes Vehicle Extension (s) 3.0 3.0 3.0 3.0 3.0 3.0 3.0 3.0 3.0 Recall Mode None None None None None Min Max Min Max Walk Time (s) 7.0 7.0 7.0 7.0 7.0 7.0 7.0 Flash Dont Walk (s) 11.0 11.0 11.0 11.0 11.0 11.0 11.0 Pedestrian Calls (#/hr) 0 0 0 0 0 0 0 Act Effct Green (s) 12.8 12.8 12.8 12.8 12.8 37.3 23.1 28.3 18.1 Actuated g/C Ratio 0.22 0.22 0.22 0.22 0.22 0.63 0.39 0.48 0.31 v/c Ratio 0.56 0.28 0.37 0.26 0.33 0.22 0.75 0.14 0.93 Control Delay 28.9 20.9 5.1 21.4 16.5 6.1 20.1 6.7 37.5 Queue Delay 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 Total Delay 28.9 20.9 5.1 21.4 16.5 6.1 20.1 6.7 37.5 Lanes, Volumes, Timings 240 Deming Street 1: Deming Street & Buckland Road 2025 PM Background Fuss & O'Neill - JJF Synchro 11 Report F:\P2023\0453\A10\Traffic\Synchro\2025 PM Background.syn Page 2 Lane Group EBL EBT EBR WBL WBT WBR NBL NBT NBR SBL SBT SBR LOS C C A C B A C A D Approach Delay 17.1 18.2 18.7 35.9 Approach LOS B B B D Queue Length 50th (ft) 48 34 0 21 29 15 163 7 181 Queue Length 95th (ft) 98 71 35 50 69 35 242 19 #316 Internal Link Dist (ft) 369 232 484 432 Turn Bay Length (ft) 150 130 150 300 Base Capacity (vph) 338 505 577 345 508 528 1373 381 1076 Starvation Cap Reductn 0 0 0 0 0 0 0 0 0 Spillback Cap Reductn 0 0 0 0 0 0 0 0 0 Storage Cap Reductn 0 0 0 0 0 0 0 0 0 Reduced v/c Ratio 0.44 0.23 0.32 0.21 0.27 0.22 0.75 0.14 0.93 Intersection Summary Area Type: Other Cycle Length: 60 Actuated Cycle Length: 59.2 Natural Cycle: 70 Control Type: Actuated-Uncoordinated Maximum v/c Ratio: 0.93 Intersection Signal Delay: 24.7 Intersection LOS: C Intersection Capacity Utilization 70.3% ICU Level of Service C Analysis Period (min) 15 # 95th percentile volume exceeds capacity, queue may be longer. Queue shown is maximum after two cycles. Splits and Phases: 1: Deming Street & Buckland Road HCM Signalized Intersection Capacity Analysis 240 Deming Street 1: Deming Street & Buckland Road 2025 PM Background Fuss & O'Neill - JJF Synchro 11 Report F:\P2023\0453\A10\Traffic\Synchro\2025 PM Background.syn Page 3 Movement EBL EBT EBR WBL WBT WBR NBL NBT NBR SBL SBT SBR Lane Configurations Traffic Volume (vph) 138 106 170 65 86 40 109 867 77 51 817 103 Future Volume (vph) 138 106 170 65 86 40 109 867 77 51 817 103 Ideal Flow (vphpl) 1900 1900 1900 1900 1900 1900 1900 1900 1900 1900 1900 1900 Total Lost time (s) 5.0 5.0 5.0 5.0 5.0 4.0 6.2 4.0 6.2 Lane Util. Factor 1.00 1.00 1.00 1.00 1.00 1.00 0.95 1.00 0.95 Frt 1.00 1.00 0.85 1.00 0.95 1.00 0.99 1.00 0.98 Flt Protected 0.95 1.00 1.00 0.95 1.00 0.95 1.00 0.95 1.00 Satd. Flow (prot) 1770 1863 1583 1770 1774 1770 3496 1770 3480 Flt Permitted 0.67 1.00 1.00 0.68 1.00 0.18 1.00 0.22 1.00 Satd. Flow (perm) 1248 1863 1583 1272 1774 337 3496 412 3480 Peak-hour factor, PHF 0.92 0.92 0.92 0.92 0.92 0.92 0.92 0.92 0.92 0.92 0.92 0.92 Adj. Flow (vph) 150 115 185 71 93 43 118 942 84 55 888 112 RTOR Reduction (vph) 0 0 145 0 30 0 0 10 0 0 15 0 Lane Group Flow (vph) 150 115 40 71 106 0 118 1016 0 55 985 0 Turn Type Perm NA Perm Perm NA pm+pt NA pm+pt NA Protected Phases 4 4 5 2 1 6 Permitted Phases 4 4 4 2 6 Actuated Green, G (s) 12.8 12.8 12.8 12.8 12.8 35.1 23.1 26.1 18.1 Effective Green, g (s) 12.8 12.8 12.8 12.8 12.8 35.1 23.1 26.1 18.1 Actuated g/C Ratio 0.22 0.22 0.22 0.22 0.22 0.59 0.39 0.44 0.31 Clearance Time (s) 5.0 5.0 5.0 5.0 5.0 4.0 6.2 4.0 6.2 Vehicle Extension (s) 3.0 3.0 3.0 3.0 3.0 3.0 3.0 3.0 3.0 Lane Grp Cap (vph) 270 403 342 275 384 515 1366 365 1065 v/s Ratio Prot 0.06 0.06 c0.05 c0.29 0.02 c0.28 v/s Ratio Perm c0.12 0.03 0.06 0.09 0.05 v/c Ratio 0.56 0.29 0.12 0.26 0.28 0.23 0.74 0.15 0.92 Uniform Delay, d1 20.6 19.3 18.6 19.2 19.3 7.3 15.5 9.7 19.8 Progression Factor 1.00 1.00 1.00 1.00 1.00 1.00 1.00 1.00 1.00 Incremental Delay, d2 2.5 0.4 0.2 0.5 0.4 0.2 3.7 0.2 14.5 Delay (s) 23.1 19.7 18.8 19.7 19.7 7.5 19.2 9.9 34.4 Level of Service C B B B B A B A C Approach Delay (s) 20.4 19.7 18.0 33.1 Approach LOS C B B C Intersection Summary HCM 2000 Control Delay 24.1 HCM 2000 Level of Service C HCM 2000 Volume to Capacity ratio 0.63 Actuated Cycle Length (s) 59.1 Sum of lost time (s) 15.2 Intersection Capacity Utilization 70.3% ICU Level of Service C Analysis Period (min) 15 c Critical Lane Group Lanes, Volumes, Timings 240 Deming Street 1: Deming Street & Buckland Road 2025 PM Combined Fuss & O'Neill - JJF Synchro 11 Report F:\P2023\0453\A10\Traffic\Synchro\2025 PM Combined.syn Page 1 Lane Group EBL EBT EBR WBL WBT WBR NBL NBT NBR SBL SBT SBR Lane Configurations Traffic Volume (vph) 138 109 170 69 88 43 109 867 84 56 817 103 Future Volume (vph) 138 109 170 69 88 43 109 867 84 56 817 103 Ideal Flow (vphpl) 1900 1900 1900 1900 1900 1900 1900 1900 1900 1900 1900 1900 Storage Length (ft) 150 0 130 0 150 0 300 0 Storage Lanes 1 1 1 0 1 0 1 0 Taper Length (ft) 25 25 25 25 Lane Util. Factor 1.00 1.00 1.00 1.00 1.00 1.00 1.00 0.95 0.95 1.00 0.95 0.95 Frt 0.850 0.951 0.987 0.983 Flt Protected 0.950 0.950 0.950 0.950 Satd. Flow (prot) 1770 1863 1583 1770 1771 0 1770 3493 0 1770 3479 0 Flt Permitted 0.666 0.681 0.181 0.221 Satd. Flow (perm) 1241 1863 1583 1269 1771 0 337 3493 0 412 3479 0 Right Turn on Red Yes Yes Yes Yes Satd. Flow (RTOR) 204 40 18 22 Link Speed (mph) 30 30 30 30 Link Distance (ft) 152 625 564 183 Travel Time (s) 3.5 14.2 12.8 4.2 Peak Hour Factor 0.92 0.92 0.92 0.92 0.92 0.92 0.92 0.92 0.92 0.92 0.92 0.92 Adj. Flow (vph) 150 118 185 75 96 47 118 942 91 61 888 112 Shared Lane Traffic (%) Lane Group Flow (vph) 150 118 185 75 143 0 118 1033 0 61 1000 0 Turn Type Perm NA Perm Perm NA pm+pt NA pm+pt NA Protected Phases 4 4 5 2 1 6 Permitted Phases 4 4 4 2 6 Detector Phase 4 4 4 4 4 5 2 1 6 Switch Phase Minimum Initial (s) 9.0 9.0 9.0 9.0 9.0 15.0 15.0 10.0 15.0 Minimum Split (s) 23.0 23.0 23.0 23.0 23.0 19.0 24.2 14.0 24.2 Total Split (s) 21.0 21.0 21.0 21.0 21.0 17.0 27.0 12.0 22.0 Total Split (%) 35.0% 35.0% 35.0% 35.0% 35.0% 28.3% 45.0% 20.0% 36.7% Maximum Green (s) 16.0 16.0 16.0 16.0 16.0 13.0 20.8 8.0 15.8 Yellow Time (s) 3.0 3.0 3.0 3.0 3.0 3.0 4.2 3.0 4.2 All-Red Time (s) 2.0 2.0 2.0 2.0 2.0 1.0 2.0 1.0 2.0 Lost Time Adjust (s) 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 Total Lost Time (s) 5.0 5.0 5.0 5.0 5.0 4.0 6.2 4.0 6.2 Lead/Lag Lead Lag Lead Lag Lead-Lag Optimize?Yes Yes Yes Yes Vehicle Extension (s) 3.0 3.0 3.0 3.0 3.0 3.0 3.0 3.0 3.0 Recall Mode None None None None None Min Max Min Max Walk Time (s) 7.0 7.0 7.0 7.0 7.0 7.0 7.0 Flash Dont Walk (s) 11.0 11.0 11.0 11.0 11.0 11.0 11.0 Pedestrian Calls (#/hr) 0 0 0 0 0 0 0 Act Effct Green (s) 13.8 13.8 13.8 13.8 13.8 37.3 23.0 28.3 18.0 Actuated g/C Ratio 0.23 0.23 0.23 0.23 0.23 0.62 0.38 0.47 0.30 v/c Ratio 0.53 0.28 0.36 0.26 0.33 0.23 0.77 0.16 0.94 Control Delay 27.5 20.6 4.9 21.1 16.2 6.4 21.2 7.0 40.2 Queue Delay 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 Total Delay 27.5 20.6 4.9 21.1 16.2 6.4 21.2 7.0 40.2 Lanes, Volumes, Timings 240 Deming Street 1: Deming Street & Buckland Road 2025 PM Combined Fuss & O'Neill - JJF Synchro 11 Report F:\P2023\0453\A10\Traffic\Synchro\2025 PM Combined.syn Page 2 Lane Group EBL EBT EBR WBL WBT WBR NBL NBT NBR SBL SBT SBR LOS C C A C B A C A D Approach Delay 16.4 17.9 19.7 38.3 Approach LOS B B B D Queue Length 50th (ft) 48 35 0 22 31 17 174 8 191 Queue Length 95th (ft) 98 73 35 53 72 35 244 21 #316 Internal Link Dist (ft) 72 545 484 103 Turn Bay Length (ft) 150 130 150 300 Base Capacity (vph) 331 497 571 338 501 519 1350 374 1059 Starvation Cap Reductn 0 0 0 0 0 0 0 0 0 Spillback Cap Reductn 0 0 0 0 0 0 0 0 0 Storage Cap Reductn 0 0 0 0 0 0 0 0 0 Reduced v/c Ratio 0.45 0.24 0.32 0.22 0.29 0.23 0.77 0.16 0.94 Intersection Summary Area Type: Other Cycle Length: 60 Actuated Cycle Length: 60.1 Natural Cycle: 70 Control Type: Actuated-Uncoordinated Maximum v/c Ratio: 0.94 Intersection Signal Delay: 25.9 Intersection LOS: C Intersection Capacity Utilization 70.3% ICU Level of Service C Analysis Period (min) 15 # 95th percentile volume exceeds capacity, queue may be longer. Queue shown is maximum after two cycles. Splits and Phases: 1: Deming Street & Buckland Road HCM Signalized Intersection Capacity Analysis 240 Deming Street 1: Deming Street & Buckland Road 2025 PM Combined Fuss & O'Neill - JJF Synchro 11 Report F:\P2023\0453\A10\Traffic\Synchro\2025 PM Combined.syn Page 3 Movement EBL EBT EBR WBL WBT WBR NBL NBT NBR SBL SBT SBR Lane Configurations Traffic Volume (vph) 138 109 170 69 88 43 109 867 84 56 817 103 Future Volume (vph) 138 109 170 69 88 43 109 867 84 56 817 103 Ideal Flow (vphpl) 1900 1900 1900 1900 1900 1900 1900 1900 1900 1900 1900 1900 Total Lost time (s) 5.0 5.0 5.0 5.0 5.0 4.0 6.2 4.0 6.2 Lane Util. Factor 1.00 1.00 1.00 1.00 1.00 1.00 0.95 1.00 0.95 Frt 1.00 1.00 0.85 1.00 0.95 1.00 0.99 1.00 0.98 Flt Protected 0.95 1.00 1.00 0.95 1.00 0.95 1.00 0.95 1.00 Satd. Flow (prot) 1770 1863 1583 1770 1771 1770 3492 1770 3480 Flt Permitted 0.67 1.00 1.00 0.68 1.00 0.18 1.00 0.22 1.00 Satd. Flow (perm) 1240 1863 1583 1269 1771 337 3492 412 3480 Peak-hour factor, PHF 0.92 0.92 0.92 0.92 0.92 0.92 0.92 0.92 0.92 0.92 0.92 0.92 Adj. Flow (vph) 150 118 185 75 96 47 118 942 91 61 888 112 RTOR Reduction (vph) 0 0 143 0 31 0 0 11 0 0 15 0 Lane Group Flow (vph) 150 118 42 75 112 0 118 1022 0 61 985 0 Turn Type Perm NA Perm Perm NA pm+pt NA pm+pt NA Protected Phases 4 4 5 2 1 6 Permitted Phases 4 4 4 2 6 Actuated Green, G (s) 13.8 13.8 13.8 13.8 13.8 35.1 23.1 26.1 18.1 Effective Green, g (s) 13.8 13.8 13.8 13.8 13.8 35.1 23.1 26.1 18.1 Actuated g/C Ratio 0.23 0.23 0.23 0.23 0.23 0.58 0.38 0.43 0.30 Clearance Time (s) 5.0 5.0 5.0 5.0 5.0 4.0 6.2 4.0 6.2 Vehicle Extension (s) 3.0 3.0 3.0 3.0 3.0 3.0 3.0 3.0 3.0 Lane Grp Cap (vph) 284 427 363 291 406 506 1342 359 1048 v/s Ratio Prot 0.06 0.06 c0.05 c0.29 0.02 c0.28 v/s Ratio Perm c0.12 0.03 0.06 0.09 0.05 v/c Ratio 0.53 0.28 0.12 0.26 0.28 0.23 0.76 0.17 0.94 Uniform Delay, d1 20.3 19.0 18.3 19.0 19.0 7.7 16.1 10.2 20.5 Progression Factor 1.00 1.00 1.00 1.00 1.00 1.00 1.00 1.00 1.00 Incremental Delay, d2 1.8 0.4 0.1 0.5 0.4 0.2 4.1 0.2 16.6 Delay (s) 22.1 19.4 18.5 19.4 19.4 8.0 20.2 10.4 37.0 Level of Service C B B B B A C B D Approach Delay (s) 19.9 19.4 19.0 35.5 Approach LOS B B B D Intersection Summary HCM 2000 Control Delay 25.2 HCM 2000 Level of Service C HCM 2000 Volume to Capacity ratio 0.63 Actuated Cycle Length (s) 60.1 Sum of lost time (s) 15.2 Intersection Capacity Utilization 70.3% ICU Level of Service C Analysis Period (min) 15 c Critical Lane Group Lanes, Volumes, Timings 240 Deming Street 2: Deming Street & Site Driveway 2025 PM Combined Fuss & O'Neill - JJF Synchro 11 Report F:\P2023\0453\A10\Traffic\Synchro\2025 PM Combined.syn Page 4 Lane Group EBL EBT WBT WBR SBL SBR Lane Configurations Traffic Volume (vph) 15 234 191 2 2 9 Future Volume (vph) 15 234 191 2 2 9 Ideal Flow (vphpl) 1900 1900 1900 1900 1900 1900 Lane Util. Factor 1.00 1.00 1.00 1.00 1.00 1.00 Frt 0.999 0.887 Flt Protected 0.997 0.992 Satd. Flow (prot) 0 1857 1861 0 1639 0 Flt Permitted 0.997 0.992 Satd. Flow (perm) 0 1857 1861 0 1639 0 Link Speed (mph) 30 30 30 Link Distance (ft) 625 300 155 Travel Time (s) 14.2 6.8 3.5 Peak Hour Factor 0.92 0.92 0.92 0.92 0.92 0.92 Adj. Flow (vph) 16 254 208 2 2 10 Shared Lane Traffic (%) Lane Group Flow (vph) 0 270 210 0 12 0 Sign Control Free Free Stop Intersection Summary Area Type: Other Control Type: Unsignalized Intersection Capacity Utilization 34.6% ICU Level of Service A Analysis Period (min) 15 HCM Unsignalized Intersection Capacity Analysis 240 Deming Street 2: Deming Street & Site Driveway 2025 PM Combined Fuss & O'Neill - JJF Synchro 11 Report F:\P2023\0453\A10\Traffic\Synchro\2025 PM Combined.syn Page 5 Movement EBL EBT WBT WBR SBL SBR Lane Configurations Traffic Volume (veh/h) 15 234 191 2 2 9 Future Volume (Veh/h) 15 234 191 2 2 9 Sign Control Free Free Stop Grade 0% 0% 0% Peak Hour Factor 0.92 0.92 0.92 0.92 0.92 0.92 Hourly flow rate (vph) 16 254 208 2 2 10 Pedestrians Lane Width (ft) Walking Speed (ft/s) Percent Blockage Right turn flare (veh) Median type None None Median storage veh) Upstream signal (ft) 625 pX, platoon unblocked vC, conflicting volume 210 495 209 vC1, stage 1 conf vol vC2, stage 2 conf vol vCu, unblocked vol 210 495 209 tC, single (s) 4.1 6.4 6.2 tC, 2 stage (s) tF (s) 2.2 3.5 3.3 p0 queue free % 99 100 99 cM capacity (veh/h) 1361 528 831 Direction, Lane # EB 1 WB 1 SB 1 Volume Total 270 210 12 Volume Left 16 0 2 Volume Right 0 2 10 cSH 1361 1700 759 Volume to Capacity 0.01 0.12 0.02 Queue Length 95th (ft) 1 0 1 Control Delay (s) 0.6 0.0 9.8 Lane LOS A A Approach Delay (s) 0.6 0.0 9.8 Approach LOS A Intersection Summary Average Delay 0.5 Intersection Capacity Utilization 34.6% ICU Level of Service A Analysis Period (min) 15 Lanes, Volumes, Timings 240 Deming Street 1: Deming Street & Buckland Road 2025 PM Combined Improved Fuss & O'Neill - JJF Synchro 11 Report F:\P2023\0453\A10\Traffic\Synchro\2025 PM Combined Improved.syn Page 1 Lane Group EBL EBT EBR WBL WBT WBR NBL NBT NBR SBL SBT SBR Lane Configurations Traffic Volume (vph) 138 109 170 69 88 43 109 867 84 56 817 103 Future Volume (vph) 138 109 170 69 88 43 109 867 84 56 817 103 Ideal Flow (vphpl) 1900 1900 1900 1900 1900 1900 1900 1900 1900 1900 1900 1900 Storage Length (ft) 150 0 130 100 150 0 300 0 Storage Lanes 1 1 1 1 1 0 1 0 Taper Length (ft) 25 25 25 25 Lane Util. Factor 1.00 1.00 1.00 1.00 1.00 1.00 1.00 0.95 0.95 1.00 0.95 0.95 Frt 0.850 0.850 0.987 0.983 Flt Protected 0.950 0.950 0.950 0.950 Satd. Flow (prot) 1770 1863 1583 1770 1863 1583 1770 3493 0 1770 3479 0 Flt Permitted 0.695 0.681 0.181 0.221 Satd. Flow (perm) 1295 1863 1583 1269 1863 1583 337 3493 0 412 3479 0 Right Turn on Red Yes Yes Yes Yes Satd. Flow (RTOR) 204 204 18 22 Link Speed (mph) 30 30 30 30 Link Distance (ft) 152 625 564 183 Travel Time (s) 3.5 14.2 12.8 4.2 Peak Hour Factor 0.92 0.92 0.92 0.92 0.92 0.92 0.92 0.92 0.92 0.92 0.92 0.92 Adj. Flow (vph) 150 118 185 75 96 47 118 942 91 61 888 112 Shared Lane Traffic (%) Lane Group Flow (vph) 150 118 185 75 96 47 118 1033 0 61 1000 0 Turn Type Perm NA Perm Perm NA Perm pm+pt NA pm+pt NA Protected Phases 4 4 5 2 1 6 Permitted Phases 4 4 4 4 2 6 Detector Phase 4 4 4 4 4 4 5 2 1 6 Switch Phase Minimum Initial (s) 9.0 9.0 9.0 9.0 9.0 9.0 15.0 15.0 10.0 15.0 Minimum Split (s) 23.0 23.0 23.0 23.0 23.0 23.0 19.0 24.2 14.0 24.2 Total Split (s) 21.0 21.0 21.0 21.0 21.0 21.0 17.0 27.0 12.0 22.0 Total Split (%) 35.0% 35.0% 35.0% 35.0% 35.0% 35.0% 28.3% 45.0% 20.0% 36.7% Maximum Green (s) 16.0 16.0 16.0 16.0 16.0 16.0 13.0 20.8 8.0 15.8 Yellow Time (s) 3.0 3.0 3.0 3.0 3.0 3.0 3.0 4.2 3.0 4.2 All-Red Time (s) 2.0 2.0 2.0 2.0 2.0 2.0 1.0 2.0 1.0 2.0 Lost Time Adjust (s) 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 Total Lost Time (s) 5.0 5.0 5.0 5.0 5.0 5.0 4.0 6.2 4.0 6.2 Lead/Lag Lead Lag Lead Lag Lead-Lag Optimize?Yes Yes Yes Yes Vehicle Extension (s) 3.0 3.0 3.0 3.0 3.0 3.0 3.0 3.0 3.0 3.0 Recall Mode None None None None None None Min Max Min Max Walk Time (s) 7.0 7.0 7.0 7.0 7.0 7.0 7.0 7.0 Flash Dont Walk (s) 11.0 11.0 11.0 11.0 11.0 11.0 11.0 11.0 Pedestrian Calls (#/hr) 0 0 0 0 0 0 0 0 Act Effct Green (s) 12.7 12.7 12.7 12.7 12.7 12.7 37.3 23.1 28.3 18.1 Actuated g/C Ratio 0.21 0.21 0.21 0.21 0.21 0.21 0.63 0.39 0.48 0.31 v/c Ratio 0.54 0.29 0.37 0.27 0.24 0.09 0.22 0.75 0.16 0.93 Control Delay 28.0 21.1 5.1 21.7 20.4 0.4 6.1 20.3 6.8 37.2 Queue Delay 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 Total Delay 28.0 21.1 5.1 21.7 20.4 0.4 6.1 20.3 6.8 37.2 Lanes, Volumes, Timings 240 Deming Street 1: Deming Street & Buckland Road 2025 PM Combined Improved Fuss & O'Neill - JJF Synchro 11 Report F:\P2023\0453\A10\Traffic\Synchro\2025 PM Combined Improved.syn Page 2 Lane Group EBL EBT EBR WBL WBT WBR NBL NBT NBR SBL SBT SBR LOS C C A C C A A C A D Approach Delay 16.9 16.5 18.8 35.5 Approach LOS B B B D Queue Length 50th (ft) 47 35 0 22 28 0 15 162 7 180 Queue Length 95th (ft) 97 73 35 53 62 0 35 244 21 #316 Internal Link Dist (ft) 72 545 484 103 Turn Bay Length (ft) 150 130 100 150 300 Base Capacity (vph) 351 506 578 344 506 578 529 1374 381 1078 Starvation Cap Reductn 0 0 0 0 0 0 0 0 0 0 Spillback Cap Reductn 0 0 0 0 0 0 0 0 0 0 Storage Cap Reductn 0 0 0 0 0 0 0 0 0 0 Reduced v/c Ratio 0.43 0.23 0.32 0.22 0.19 0.08 0.22 0.75 0.16 0.93 Intersection Summary Area Type: Other Cycle Length: 60 Actuated Cycle Length: 59.1 Natural Cycle: 70 Control Type: Actuated-Uncoordinated Maximum v/c Ratio: 0.93 Intersection Signal Delay: 24.5 Intersection LOS: C Intersection Capacity Utilization 65.3% ICU Level of Service C Analysis Period (min) 15 # 95th percentile volume exceeds capacity, queue may be longer. Queue shown is maximum after two cycles. Splits and Phases: 1: Deming Street & Buckland Road HCM Signalized Intersection Capacity Analysis 240 Deming Street 1: Deming Street & Buckland Road 2025 PM Combined Improved Fuss & O'Neill - JJF Synchro 11 Report F:\P2023\0453\A10\Traffic\Synchro\2025 PM Combined Improved.syn Page 3 Movement EBL EBT EBR WBL WBT WBR NBL NBT NBR SBL SBT SBR Lane Configurations Traffic Volume (vph) 138 109 170 69 88 43 109 867 84 56 817 103 Future Volume (vph) 138 109 170 69 88 43 109 867 84 56 817 103 Ideal Flow (vphpl) 1900 1900 1900 1900 1900 1900 1900 1900 1900 1900 1900 1900 Total Lost time (s) 5.0 5.0 5.0 5.0 5.0 5.0 4.0 6.2 4.0 6.2 Lane Util. Factor 1.00 1.00 1.00 1.00 1.00 1.00 1.00 0.95 1.00 0.95 Frt 1.00 1.00 0.85 1.00 1.00 0.85 1.00 0.99 1.00 0.98 Flt Protected 0.95 1.00 1.00 0.95 1.00 1.00 0.95 1.00 0.95 1.00 Satd. Flow (prot) 1770 1863 1583 1770 1863 1583 1770 3492 1770 3480 Flt Permitted 0.69 1.00 1.00 0.68 1.00 1.00 0.18 1.00 0.22 1.00 Satd. Flow (perm) 1294 1863 1583 1269 1863 1583 337 3492 412 3480 Peak-hour factor, PHF 0.92 0.92 0.92 0.92 0.92 0.92 0.92 0.92 0.92 0.92 0.92 0.92 Adj. Flow (vph) 150 118 185 75 96 47 118 942 91 61 888 112 RTOR Reduction (vph) 0 0 145 0 0 37 0 11 0 0 15 0 Lane Group Flow (vph) 150 118 40 75 96 10 118 1022 0 61 985 0 Turn Type Perm NA Perm Perm NA Perm pm+pt NA pm+pt NA Protected Phases 4 4 5 2 1 6 Permitted Phases 4 4 4 4 2 6 Actuated Green, G (s) 12.7 12.7 12.7 12.7 12.7 12.7 35.1 23.1 26.1 18.1 Effective Green, g (s) 12.7 12.7 12.7 12.7 12.7 12.7 35.1 23.1 26.1 18.1 Actuated g/C Ratio 0.22 0.22 0.22 0.22 0.22 0.22 0.59 0.39 0.44 0.31 Clearance Time (s) 5.0 5.0 5.0 5.0 5.0 5.0 4.0 6.2 4.0 6.2 Vehicle Extension (s) 3.0 3.0 3.0 3.0 3.0 3.0 3.0 3.0 3.0 3.0 Lane Grp Cap (vph) 278 401 340 273 401 340 516 1367 366 1067 v/s Ratio Prot 0.06 0.05 c0.05 c0.29 0.02 c0.28 v/s Ratio Perm c0.12 0.03 0.06 0.01 0.09 0.05 v/c Ratio 0.54 0.29 0.12 0.27 0.24 0.03 0.23 0.75 0.17 0.92 Uniform Delay, d1 20.6 19.4 18.6 19.3 19.2 18.3 7.3 15.4 9.7 19.8 Progression Factor 1.00 1.00 1.00 1.00 1.00 1.00 1.00 1.00 1.00 1.00 Incremental Delay, d2 2.0 0.4 0.2 0.5 0.3 0.0 0.2 3.8 0.2 14.3 Delay (s) 22.6 19.8 18.8 19.9 19.5 18.3 7.5 19.2 9.9 34.1 Level of Service C B B B B B A B A C Approach Delay (s) 20.3 19.4 18.0 32.7 Approach LOS C B B C Intersection Summary HCM 2000 Control Delay 23.9 HCM 2000 Level of Service C HCM 2000 Volume to Capacity ratio 0.63 Actuated Cycle Length (s) 59.0 Sum of lost time (s) 15.2 Intersection Capacity Utilization 65.3% ICU Level of Service C Analysis Period (min) 15 c Critical Lane Group Lanes, Volumes, Timings 240 Deming Street 1: Deming Street & Buckland Road 2025 Saturday Background Fuss & O'Neill - JJF Synchro 11 Report F:\P2023\0453\A10\Traffic\Synchro\2025 SAT Background.syn Page 1 Lane Group EBL EBT EBR WBL WBT WBR NBL NBT NBR SBL SBT SBR Lane Configurations Traffic Volume (vph) 107 111 119 95 97 55 88 700 67 52 732 116 Future Volume (vph) 107 111 119 95 97 55 88 700 67 52 732 116 Ideal Flow (vphpl) 1900 1900 1900 1900 1900 1900 1900 1900 1900 1900 1900 1900 Storage Length (ft) 150 0 130 0 150 0 300 0 Storage Lanes 1 1 1 0 1 0 1 0 Taper Length (ft) 25 25 25 25 Lane Util. Factor 1.00 1.00 1.00 1.00 1.00 1.00 1.00 0.95 0.95 1.00 0.95 0.95 Frt 0.850 0.945 0.987 0.980 Flt Protected 0.950 0.950 0.950 0.950 Satd. Flow (prot) 1770 1863 1583 1770 1760 0 1770 3493 0 1770 3468 0 Flt Permitted 0.653 0.679 0.181 0.333 Satd. Flow (perm) 1216 1863 1583 1265 1760 0 337 3493 0 620 3468 0 Right Turn on Red Yes Yes Yes Yes Satd. Flow (RTOR) 204 47 18 29 Link Speed (mph) 30 30 30 30 Link Distance (ft) 469 312 564 517 Travel Time (s) 10.7 7.1 12.8 11.8 Peak Hour Factor 0.92 0.92 0.92 0.92 0.92 0.92 0.92 0.92 0.92 0.92 0.92 0.92 Adj. Flow (vph) 116 121 129 103 105 60 96 761 73 57 796 126 Shared Lane Traffic (%) Lane Group Flow (vph) 116 121 129 103 165 0 96 834 0 57 922 0 Turn Type Perm NA Perm Perm NA pm+pt NA pm+pt NA Protected Phases 4 4 5 2 1 6 Permitted Phases 4 4 4 2 6 Detector Phase 4 4 4 4 4 5 2 1 6 Switch Phase Minimum Initial (s) 9.0 9.0 9.0 9.0 9.0 15.0 15.0 10.0 15.0 Minimum Split (s) 23.0 23.0 23.0 23.0 23.0 19.0 24.2 14.0 24.2 Total Split (s) 21.0 21.0 21.0 21.0 21.0 17.0 27.0 12.0 22.0 Total Split (%) 35.0% 35.0% 35.0% 35.0% 35.0% 28.3% 45.0% 20.0% 36.7% Maximum Green (s) 16.0 16.0 16.0 16.0 16.0 13.0 20.8 8.0 15.8 Yellow Time (s) 3.0 3.0 3.0 3.0 3.0 3.0 4.2 3.0 4.2 All-Red Time (s) 2.0 2.0 2.0 2.0 2.0 1.0 2.0 1.0 2.0 Lost Time Adjust (s) 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 Total Lost Time (s) 5.0 5.0 5.0 5.0 5.0 4.0 6.2 4.0 6.2 Lead/Lag Lead Lag Lead Lag Lead-Lag Optimize?Yes Yes Yes Yes Vehicle Extension (s) 3.0 3.0 3.0 3.0 3.0 3.0 3.0 3.0 3.0 Recall Mode None None None None None Min Max Min Max Walk Time (s) 7.0 7.0 7.0 7.0 7.0 7.0 7.0 Flash Dont Walk (s) 11.0 11.0 11.0 11.0 11.0 11.0 11.0 Pedestrian Calls (#/hr) 0 0 0 0 0 0 0 Act Effct Green (s) 12.4 12.4 12.4 12.4 12.4 37.3 23.1 28.3 18.1 Actuated g/C Ratio 0.21 0.21 0.21 0.21 0.21 0.64 0.39 0.48 0.31 v/c Ratio 0.45 0.31 0.26 0.39 0.41 0.18 0.60 0.12 0.85 Control Delay 26.1 21.4 2.3 24.2 17.3 5.7 16.6 6.2 28.9 Queue Delay 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 Total Delay 26.1 21.4 2.3 24.2 17.3 5.7 16.6 6.2 28.9 Lanes, Volumes, Timings 240 Deming Street 1: Deming Street & Buckland Road 2025 Saturday Background Fuss & O'Neill - JJF Synchro 11 Report F:\P2023\0453\A10\Traffic\Synchro\2025 SAT Background.syn Page 2 Lane Group EBL EBT EBR WBL WBT WBR NBL NBT NBR SBL SBT SBR LOS C C A C B A B A C Approach Delay 16.2 19.9 15.5 27.6 Approach LOS B B B C Queue Length 50th (ft) 36 36 0 31 35 11 116 6 154 Queue Length 95th (ft) 77 75 11 69 80 29 185 19 #278 Internal Link Dist (ft) 389 232 484 437 Turn Bay Length (ft) 150 130 150 300 Base Capacity (vph) 332 509 580 345 515 532 1383 456 1086 Starvation Cap Reductn 0 0 0 0 0 0 0 0 0 Spillback Cap Reductn 0 0 0 0 0 0 0 0 0 Storage Cap Reductn 0 0 0 0 0 0 0 0 0 Reduced v/c Ratio 0.35 0.24 0.22 0.30 0.32 0.18 0.60 0.13 0.85 Intersection Summary Area Type: Other Cycle Length: 60 Actuated Cycle Length: 58.7 Natural Cycle: 70 Control Type: Actuated-Uncoordinated Maximum v/c Ratio: 0.85 Intersection Signal Delay: 20.7 Intersection LOS: C Intersection Capacity Utilization 69.2% ICU Level of Service C Analysis Period (min) 15 # 95th percentile volume exceeds capacity, queue may be longer. Queue shown is maximum after two cycles. Splits and Phases: 1: Deming Street & Buckland Road HCM Signalized Intersection Capacity Analysis 240 Deming Street 1: Deming Street & Buckland Road 2025 Saturday Background Fuss & O'Neill - JJF Synchro 11 Report F:\P2023\0453\A10\Traffic\Synchro\2025 SAT Background.syn Page 3 Movement EBL EBT EBR WBL WBT WBR NBL NBT NBR SBL SBT SBR Lane Configurations Traffic Volume (vph) 107 111 119 95 97 55 88 700 67 52 732 116 Future Volume (vph) 107 111 119 95 97 55 88 700 67 52 732 116 Ideal Flow (vphpl) 1900 1900 1900 1900 1900 1900 1900 1900 1900 1900 1900 1900 Total Lost time (s) 5.0 5.0 5.0 5.0 5.0 4.0 6.2 4.0 6.2 Lane Util. Factor 1.00 1.00 1.00 1.00 1.00 1.00 0.95 1.00 0.95 Frt 1.00 1.00 0.85 1.00 0.95 1.00 0.99 1.00 0.98 Flt Protected 0.95 1.00 1.00 0.95 1.00 0.95 1.00 0.95 1.00 Satd. Flow (prot) 1770 1863 1583 1770 1761 1770 3493 1770 3467 Flt Permitted 0.65 1.00 1.00 0.68 1.00 0.18 1.00 0.33 1.00 Satd. Flow (perm) 1216 1863 1583 1265 1761 337 3493 620 3467 Peak-hour factor, PHF 0.92 0.92 0.92 0.92 0.92 0.92 0.92 0.92 0.92 0.92 0.92 0.92 Adj. Flow (vph) 116 121 129 103 105 60 96 761 73 57 796 126 RTOR Reduction (vph) 0 0 102 0 37 0 0 11 0 0 20 0 Lane Group Flow (vph) 116 121 27 103 128 0 96 823 0 57 902 0 Turn Type Perm NA Perm Perm NA pm+pt NA pm+pt NA Protected Phases 4 4 5 2 1 6 Permitted Phases 4 4 4 2 6 Actuated Green, G (s) 12.4 12.4 12.4 12.4 12.4 35.1 23.1 26.1 18.1 Effective Green, g (s) 12.4 12.4 12.4 12.4 12.4 35.1 23.1 26.1 18.1 Actuated g/C Ratio 0.21 0.21 0.21 0.21 0.21 0.60 0.39 0.44 0.31 Clearance Time (s) 5.0 5.0 5.0 5.0 5.0 4.0 6.2 4.0 6.2 Vehicle Extension (s) 3.0 3.0 3.0 3.0 3.0 3.0 3.0 3.0 3.0 Lane Grp Cap (vph) 256 393 334 267 372 518 1374 432 1069 v/s Ratio Prot 0.06 0.07 c0.04 c0.24 0.02 c0.26 v/s Ratio Perm c0.10 0.02 0.08 0.07 0.04 v/c Ratio 0.45 0.31 0.08 0.39 0.34 0.19 0.60 0.13 0.84 Uniform Delay, d1 20.2 19.5 18.6 19.9 19.7 6.6 14.1 9.4 19.0 Progression Factor 1.00 1.00 1.00 1.00 1.00 1.00 1.00 1.00 1.00 Incremental Delay, d2 1.3 0.4 0.1 0.9 0.6 0.2 1.9 0.1 8.1 Delay (s) 21.5 20.0 18.7 20.8 20.2 6.8 16.1 9.5 27.1 Level of Service C B B C C A B A C Approach Delay (s) 20.0 20.5 15.1 26.1 Approach LOS B C B C Intersection Summary HCM 2000 Control Delay 20.6 HCM 2000 Level of Service C HCM 2000 Volume to Capacity ratio 0.55 Actuated Cycle Length (s) 58.7 Sum of lost time (s) 15.2 Intersection Capacity Utilization 69.2% ICU Level of Service C Analysis Period (min) 15 c Critical Lane Group Lanes, Volumes, Timings 240 Deming Street 1: Deming Street & Buckland Road 2025 Saturday Combined Fuss & O'Neill - JJF Synchro 11 Report F:\P2023\0453\A10\Traffic\Synchro\2025 SAT Combined.syn Page 1 Lane Group EBL EBT EBR WBL WBT WBR NBL NBT NBR SBL SBT SBR Lane Configurations Traffic Volume (vph) 107 113 119 101 99 59 88 700 73 56 732 116 Future Volume (vph) 107 113 119 101 99 59 88 700 73 56 732 116 Ideal Flow (vphpl) 1900 1900 1900 1900 1900 1900 1900 1900 1900 1900 1900 1900 Storage Length (ft) 150 0 130 0 150 0 300 0 Storage Lanes 1 1 1 0 1 0 1 0 Taper Length (ft) 25 25 25 25 Lane Util. Factor 1.00 1.00 1.00 1.00 1.00 1.00 1.00 0.95 0.95 1.00 0.95 0.95 Frt 0.850 0.944 0.986 0.980 Flt Protected 0.950 0.950 0.950 0.950 Satd. Flow (prot) 1770 1863 1583 1770 1758 0 1770 3490 0 1770 3468 0 Flt Permitted 0.649 0.678 0.181 0.327 Satd. Flow (perm) 1209 1863 1583 1263 1758 0 337 3490 0 609 3468 0 Right Turn on Red Yes Yes Yes Yes Satd. Flow (RTOR) 204 48 20 29 Link Speed (mph) 30 30 30 30 Link Distance (ft) 273 625 564 270 Travel Time (s) 6.2 14.2 12.8 6.1 Peak Hour Factor 0.92 0.92 0.92 0.92 0.92 0.92 0.92 0.92 0.92 0.92 0.92 0.92 Adj. Flow (vph) 116 123 129 110 108 64 96 761 79 61 796 126 Shared Lane Traffic (%) Lane Group Flow (vph) 116 123 129 110 172 0 96 840 0 61 922 0 Turn Type Perm NA Perm Perm NA pm+pt NA pm+pt NA Protected Phases 4 4 5 2 1 6 Permitted Phases 4 4 4 2 6 Detector Phase 4 4 4 4 4 5 2 1 6 Switch Phase Minimum Initial (s) 9.0 9.0 9.0 9.0 9.0 15.0 15.0 10.0 15.0 Minimum Split (s) 23.0 23.0 23.0 23.0 23.0 19.0 24.2 14.0 24.2 Total Split (s) 21.0 21.0 21.0 21.0 21.0 17.0 27.0 12.0 22.0 Total Split (%) 35.0% 35.0% 35.0% 35.0% 35.0% 28.3% 45.0% 20.0% 36.7% Maximum Green (s) 16.0 16.0 16.0 16.0 16.0 13.0 20.8 8.0 15.8 Yellow Time (s) 3.0 3.0 3.0 3.0 3.0 3.0 4.2 3.0 4.2 All-Red Time (s) 2.0 2.0 2.0 2.0 2.0 1.0 2.0 1.0 2.0 Lost Time Adjust (s) 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 Total Lost Time (s) 5.0 5.0 5.0 5.0 5.0 4.0 6.2 4.0 6.2 Lead/Lag Lead Lag Lead Lag Lead-Lag Optimize?Yes Yes Yes Yes Vehicle Extension (s) 3.0 3.0 3.0 3.0 3.0 3.0 3.0 3.0 3.0 Recall Mode None None None None None Min Max Min Max Walk Time (s) 7.0 7.0 7.0 7.0 7.0 7.0 7.0 Flash Dont Walk (s) 11.0 11.0 11.0 11.0 11.0 11.0 11.0 Pedestrian Calls (#/hr) 0 0 0 0 0 0 0 Act Effct Green (s) 12.7 12.7 12.7 12.7 12.7 37.3 23.1 28.3 18.1 Actuated g/C Ratio 0.22 0.22 0.22 0.22 0.22 0.63 0.39 0.48 0.31 v/c Ratio 0.45 0.31 0.26 0.41 0.42 0.18 0.61 0.14 0.85 Control Delay 25.8 21.3 2.2 24.5 17.4 5.8 16.9 6.4 29.4 Queue Delay 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 Total Delay 25.8 21.3 2.2 24.5 17.4 5.8 16.9 6.4 29.4 Lanes, Volumes, Timings 240 Deming Street 1: Deming Street & Buckland Road 2025 Saturday Combined Fuss & O'Neill - JJF Synchro 11 Report F:\P2023\0453\A10\Traffic\Synchro\2025 SAT Combined.syn Page 2 Lane Group EBL EBT EBR WBL WBT WBR NBL NBT NBR SBL SBT SBR LOS C C A C B A B A C Approach Delay 16.0 20.2 15.7 28.0 Approach LOS B C B C Queue Length 50th (ft) 36 37 0 34 37 12 121 7 159 Queue Length 95th (ft) 78 76 11 73 83 29 186 21 #278 Internal Link Dist (ft) 193 545 484 190 Turn Bay Length (ft) 150 130 150 300 Base Capacity (vph) 328 506 578 343 512 529 1376 449 1081 Starvation Cap Reductn 0 0 0 0 0 0 0 0 0 Spillback Cap Reductn 0 0 0 0 0 0 0 0 0 Storage Cap Reductn 0 0 0 0 0 0 0 0 0 Reduced v/c Ratio 0.35 0.24 0.22 0.32 0.34 0.18 0.61 0.14 0.85 Intersection Summary Area Type: Other Cycle Length: 60 Actuated Cycle Length: 59 Natural Cycle: 70 Control Type: Actuated-Uncoordinated Maximum v/c Ratio: 0.85 Intersection Signal Delay: 20.9 Intersection LOS: C Intersection Capacity Utilization 69.6% ICU Level of Service C Analysis Period (min) 15 # 95th percentile volume exceeds capacity, queue may be longer. Queue shown is maximum after two cycles. Splits and Phases: 1: Deming Street & Buckland Road HCM Signalized Intersection Capacity Analysis 240 Deming Street 1: Deming Street & Buckland Road 2025 Saturday Combined Fuss & O'Neill - JJF Synchro 11 Report F:\P2023\0453\A10\Traffic\Synchro\2025 SAT Combined.syn Page 3 Movement EBL EBT EBR WBL WBT WBR NBL NBT NBR SBL SBT SBR Lane Configurations Traffic Volume (vph) 107 113 119 101 99 59 88 700 73 56 732 116 Future Volume (vph) 107 113 119 101 99 59 88 700 73 56 732 116 Ideal Flow (vphpl) 1900 1900 1900 1900 1900 1900 1900 1900 1900 1900 1900 1900 Total Lost time (s) 5.0 5.0 5.0 5.0 5.0 4.0 6.2 4.0 6.2 Lane Util. Factor 1.00 1.00 1.00 1.00 1.00 1.00 0.95 1.00 0.95 Frt 1.00 1.00 0.85 1.00 0.94 1.00 0.99 1.00 0.98 Flt Protected 0.95 1.00 1.00 0.95 1.00 0.95 1.00 0.95 1.00 Satd. Flow (prot) 1770 1863 1583 1770 1759 1770 3489 1770 3467 Flt Permitted 0.65 1.00 1.00 0.68 1.00 0.18 1.00 0.33 1.00 Satd. Flow (perm) 1208 1863 1583 1263 1759 337 3489 609 3467 Peak-hour factor, PHF 0.92 0.92 0.92 0.92 0.92 0.92 0.92 0.92 0.92 0.92 0.92 0.92 Adj. Flow (vph) 116 123 129 110 108 64 96 761 79 61 796 126 RTOR Reduction (vph) 0 0 101 0 38 0 0 12 0 0 20 0 Lane Group Flow (vph) 116 123 28 110 134 0 96 828 0 61 902 0 Turn Type Perm NA Perm Perm NA pm+pt NA pm+pt NA Protected Phases 4 4 5 2 1 6 Permitted Phases 4 4 4 2 6 Actuated Green, G (s) 12.7 12.7 12.7 12.7 12.7 35.1 23.1 26.1 18.1 Effective Green, g (s) 12.7 12.7 12.7 12.7 12.7 35.1 23.1 26.1 18.1 Actuated g/C Ratio 0.22 0.22 0.22 0.22 0.22 0.59 0.39 0.44 0.31 Clearance Time (s) 5.0 5.0 5.0 5.0 5.0 4.0 6.2 4.0 6.2 Vehicle Extension (s) 3.0 3.0 3.0 3.0 3.0 3.0 3.0 3.0 3.0 Lane Grp Cap (vph) 260 401 340 271 378 516 1366 426 1063 v/s Ratio Prot 0.07 0.08 c0.04 c0.24 0.02 c0.26 v/s Ratio Perm c0.10 0.02 0.09 0.07 0.04 v/c Ratio 0.45 0.31 0.08 0.41 0.36 0.19 0.61 0.14 0.85 Uniform Delay, d1 20.1 19.5 18.5 19.9 19.7 6.7 14.3 9.5 19.2 Progression Factor 1.00 1.00 1.00 1.00 1.00 1.00 1.00 1.00 1.00 Incremental Delay, d2 1.2 0.4 0.1 1.0 0.6 0.2 2.0 0.2 8.4 Delay (s) 21.3 19.9 18.6 20.9 20.2 6.9 16.3 9.7 27.6 Level of Service C B B C C A B A C Approach Delay (s) 19.9 20.5 15.4 26.5 Approach LOS B C B C Intersection Summary HCM 2000 Control Delay 20.8 HCM 2000 Level of Service C HCM 2000 Volume to Capacity ratio 0.55 Actuated Cycle Length (s) 59.0 Sum of lost time (s) 15.2 Intersection Capacity Utilization 69.6% ICU Level of Service C Analysis Period (min) 15 c Critical Lane Group Lanes, Volumes, Timings 240 Deming Street 2: Deming Street & Site Driveway 2025 Saturday Combined Fuss & O'Neill - JJF Synchro 11 Report F:\P2023\0453\A10\Traffic\Synchro\2025 SAT Combined.syn Page 4 Lane Group EBL EBT WBT WBR SBL SBR Lane Configurations Traffic Volume (vph) 12 230 247 2 2 12 Future Volume (vph) 12 230 247 2 2 12 Ideal Flow (vphpl) 1900 1900 1900 1900 1900 1900 Lane Util. Factor 1.00 1.00 1.00 1.00 1.00 1.00 Frt 0.999 0.883 Flt Protected 0.998 0.993 Satd. Flow (prot) 0 1859 1861 0 1633 0 Flt Permitted 0.998 0.993 Satd. Flow (perm) 0 1859 1861 0 1633 0 Link Speed (mph) 30 30 30 Link Distance (ft) 625 300 155 Travel Time (s) 14.2 6.8 3.5 Peak Hour Factor 0.92 0.92 0.92 0.92 0.92 0.92 Adj. Flow (vph) 13 250 268 2 2 13 Shared Lane Traffic (%) Lane Group Flow (vph) 0 263 270 0 15 0 Sign Control Free Free Stop Intersection Summary Area Type: Other Control Type: Unsignalized Intersection Capacity Utilization 31.9% ICU Level of Service A Analysis Period (min) 15 HCM Unsignalized Intersection Capacity Analysis 240 Deming Street 2: Deming Street & Site Driveway 2025 Saturday Combined Fuss & O'Neill - JJF Synchro 11 Report F:\P2023\0453\A10\Traffic\Synchro\2025 SAT Combined.syn Page 5 Movement EBL EBT WBT WBR SBL SBR Lane Configurations Traffic Volume (veh/h) 12 230 247 2 2 12 Future Volume (Veh/h) 12 230 247 2 2 12 Sign Control Free Free Stop Grade 0% 0% 0% Peak Hour Factor 0.92 0.92 0.92 0.92 0.92 0.92 Hourly flow rate (vph) 13 250 268 2 2 13 Pedestrians Lane Width (ft) Walking Speed (ft/s) Percent Blockage Right turn flare (veh) Median type None None Median storage veh) Upstream signal (ft) 625 pX, platoon unblocked vC, conflicting volume 270 545 269 vC1, stage 1 conf vol vC2, stage 2 conf vol vCu, unblocked vol 270 545 269 tC, single (s) 4.1 6.4 6.2 tC, 2 stage (s) tF (s) 2.2 3.5 3.3 p0 queue free % 99 100 98 cM capacity (veh/h) 1293 494 770 Direction, Lane # EB 1 WB 1 SB 1 Volume Total 263 270 15 Volume Left 13 0 2 Volume Right 0 2 13 cSH 1293 1700 716 Volume to Capacity 0.01 0.16 0.02 Queue Length 95th (ft) 1 0 2 Control Delay (s) 0.5 0.0 10.1 Lane LOS A B Approach Delay (s) 0.5 0.0 10.1 Approach LOS B Intersection Summary Average Delay 0.5 Intersection Capacity Utilization 31.9% ICU Level of Service A Analysis Period (min) 15 Lanes, Volumes, Timings 240 Deming Street 1: Deming Street & Buckland Road 2025 Saturday Combined Improved Fuss & O'Neill - JJF Synchro 11 Report F:\P2023\0453\A10\Traffic\Synchro\2025 SAT Combined Improved.syn Page 1 Lane Group EBL EBT EBR WBL WBT WBR NBL NBT NBR SBL SBT SBR Lane Configurations Traffic Volume (vph) 107 113 119 101 99 59 88 700 73 56 732 116 Future Volume (vph) 107 113 119 101 99 59 88 700 73 56 732 116 Ideal Flow (vphpl) 1900 1900 1900 1900 1900 1900 1900 1900 1900 1900 1900 1900 Storage Length (ft) 150 0 130 100 150 0 300 0 Storage Lanes 1 1 1 1 1 0 1 0 Taper Length (ft) 25 25 25 25 Lane Util. Factor 1.00 1.00 1.00 1.00 1.00 1.00 1.00 0.95 0.95 1.00 0.95 0.95 Frt 0.850 0.850 0.986 0.980 Flt Protected 0.950 0.950 0.950 0.950 Satd. Flow (prot) 1770 1863 1583 1770 1863 1583 1770 3490 0 1770 3468 0 Flt Permitted 0.687 0.678 0.179 0.336 Satd. Flow (perm) 1280 1863 1583 1263 1863 1583 333 3490 0 626 3468 0 Right Turn on Red Yes Yes Yes Yes Satd. Flow (RTOR) 204 295 20 29 Link Speed (mph) 30 30 30 30 Link Distance (ft) 273 625 564 270 Travel Time (s) 6.2 14.2 12.8 6.1 Peak Hour Factor 0.92 0.92 0.92 0.92 0.92 0.92 0.92 0.92 0.92 0.92 0.92 0.92 Adj. Flow (vph) 116 123 129 110 108 64 96 761 79 61 796 126 Shared Lane Traffic (%) Lane Group Flow (vph) 116 123 129 110 108 64 96 840 0 61 922 0 Turn Type Perm NA Perm Perm NA NA pm+pt NA pm+pt NA Protected Phases 4 4 5 2 1 6 Permitted Phases 4 4 4 2 6 Detector Phase 4 4 4 4 4 5 2 1 6 Switch Phase Minimum Initial (s) 9.0 9.0 9.0 9.0 9.0 15.0 15.0 10.0 15.0 Minimum Split (s) 23.0 23.0 23.0 23.0 23.0 19.0 24.2 14.0 24.2 Total Split (s) 21.0 21.0 21.0 21.0 21.0 17.0 27.0 12.0 22.0 Total Split (%) 35.0% 35.0% 35.0% 35.0% 35.0% 28.3% 45.0% 20.0% 36.7% Maximum Green (s) 16.0 16.0 16.0 16.0 16.0 13.0 20.8 8.0 15.8 Yellow Time (s) 3.0 3.0 3.0 3.0 3.0 3.0 4.2 3.0 4.2 All-Red Time (s) 2.0 2.0 2.0 2.0 2.0 1.0 2.0 1.0 2.0 Lost Time Adjust (s) 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 Total Lost Time (s) 5.0 5.0 5.0 5.0 5.0 4.0 6.2 4.0 6.2 Lead/Lag Lead Lag Lead Lag Lead-Lag Optimize?Yes Yes Yes Yes Vehicle Extension (s) 3.0 3.0 3.0 3.0 3.0 3.0 3.0 3.0 3.0 Recall Mode None None None None None Min Max Min Max Walk Time (s) 7.0 7.0 7.0 7.0 7.0 7.0 7.0 Flash Dont Walk (s) 11.0 11.0 11.0 11.0 11.0 11.0 11.0 Pedestrian Calls (#/hr) 0 0 0 0 0 0 0 Act Effct Green (s) 12.0 12.0 12.0 12.0 12.0 0.0 38.0 23.5 28.8 18.4 Actuated g/C Ratio 0.22 0.22 0.22 0.22 0.22 0.00 0.68 0.42 0.52 0.33 v/c Ratio 0.42 0.30 0.26 0.40 0.27 0.22 0.17 0.56 0.12 0.79 Control Delay 24.9 21.5 2.2 24.6 20.9 1.7 5.5 15.3 6.1 25.0 Queue Delay 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 Total Delay 24.9 21.5 2.2 24.6 20.9 1.7 5.5 15.3 6.1 25.0 Lanes, Volumes, Timings 240 Deming Street 1: Deming Street & Buckland Road 2025 Saturday Combined Improved Fuss & O'Neill - JJF Synchro 11 Report F:\P2023\0453\A10\Traffic\Synchro\2025 SAT Combined Improved.syn Page 2 Lane Group EBL EBT EBR WBL WBT WBR NBL NBT NBR SBL SBT SBR LOS C C A C C A A B A C Approach Delay 15.8 18.0 14.3 23.9 Approach LOS B B B C Queue Length 50th (ft) 36 37 0 34 32 0 10 112 6 148 Queue Length 95th (ft) 77 76 11 73 67 0 29 186 21 #278 Internal Link Dist (ft) 193 545 484 190 Turn Bay Length (ft) 150 130 100 150 300 Base Capacity (vph) 377 549 610 372 549 295 572 1490 493 1169 Starvation Cap Reductn 0 0 0 0 0 0 0 0 0 0 Spillback Cap Reductn 0 0 0 0 0 0 0 0 0 0 Storage Cap Reductn 0 0 0 0 0 0 0 0 0 0 Reduced v/c Ratio 0.31 0.22 0.21 0.30 0.20 0.22 0.17 0.56 0.12 0.79 Intersection Summary Area Type: Other Cycle Length: 60 Actuated Cycle Length: 55.5 Natural Cycle: 70 Control Type: Actuated-Uncoordinated Maximum v/c Ratio: 0.79 Intersection Signal Delay: 18.6 Intersection LOS: B Intersection Capacity Utilization 61.7% ICU Level of Service B Analysis Period (min) 15 # 95th percentile volume exceeds capacity, queue may be longer. Queue shown is maximum after two cycles. Splits and Phases: 1: Deming Street & Buckland Road HCM Signalized Intersection Capacity Analysis 240 Deming Street 1: Deming Street & Buckland Road 2025 Saturday Combined Improved Fuss & O'Neill - JJF Synchro 11 Report F:\P2023\0453\A10\Traffic\Synchro\2025 SAT Combined Improved.syn Page 3 Movement EBL EBT EBR WBL WBT WBR NBL NBT NBR SBL SBT SBR Lane Configurations Traffic Volume (vph) 107 113 119 101 99 59 88 700 73 56 732 116 Future Volume (vph) 107 113 119 101 99 59 88 700 73 56 732 116 Ideal Flow (vphpl) 1900 1900 1900 1900 1900 1900 1900 1900 1900 1900 1900 1900 Total Lost time (s) 5.0 5.0 5.0 5.0 5.0 4.0 4.0 6.2 4.0 6.2 Lane Util. Factor 1.00 1.00 1.00 1.00 1.00 1.00 1.00 0.95 1.00 0.95 Frt 1.00 1.00 0.85 1.00 1.00 0.85 1.00 0.99 1.00 0.98 Flt Protected 0.95 1.00 1.00 0.95 1.00 1.00 0.95 1.00 0.95 1.00 Satd. Flow (prot) 1770 1863 1583 1770 1863 1583 1770 3489 1770 3467 Flt Permitted 0.69 1.00 1.00 0.68 1.00 1.00 0.18 1.00 0.34 1.00 Satd. Flow (perm) 1280 1863 1583 1263 1863 1583 333 3489 626 3467 Peak-hour factor, PHF 0.92 0.92 0.92 0.92 0.92 0.92 0.92 0.92 0.92 0.92 0.92 0.92 Adj. Flow (vph) 116 123 129 110 108 64 96 761 79 61 796 126 RTOR Reduction (vph) 0 0 107 0 0 64 0 12 0 0 20 0 Lane Group Flow (vph) 116 123 22 110 108 0 96 828 0 61 902 0 Turn Type Perm NA Perm Perm NA NA pm+pt NA pm+pt NA Protected Phases 4 4 5 2 1 6 Permitted Phases 4 4 4 2 6 Actuated Green, G (s) 9.6 9.6 9.6 9.6 9.6 0.0 35.7 23.5 26.6 18.4 Effective Green, g (s) 9.6 9.6 9.6 9.6 9.6 0.0 35.7 23.5 26.6 18.4 Actuated g/C Ratio 0.17 0.17 0.17 0.17 0.17 0.00 0.63 0.42 0.47 0.33 Clearance Time (s) 5.0 5.0 5.0 5.0 5.0 4.0 6.2 4.0 6.2 Vehicle Extension (s) 3.0 3.0 3.0 3.0 3.0 3.0 3.0 3.0 3.0 Lane Grp Cap (vph) 217 316 268 214 316 0 548 1451 460 1129 v/s Ratio Prot 0.07 0.06 c0.04 c0.24 0.02 c0.26 v/s Ratio Perm c0.09 0.01 0.09 0.07 0.04 v/c Ratio 0.53 0.39 0.08 0.51 0.34 0.00 0.18 0.57 0.13 0.80 Uniform Delay, d1 21.4 20.8 19.7 21.3 20.7 28.2 5.5 12.6 8.2 17.4 Progression Factor 1.00 1.00 1.00 1.00 1.00 1.00 1.00 1.00 1.00 1.00 Incremental Delay, d2 2.5 0.8 0.1 2.1 0.6 0.0 0.2 1.6 0.1 6.0 Delay (s) 23.9 21.6 19.9 23.4 21.3 28.2 5.6 14.3 8.3 23.3 Level of Service C C B C C C A B A C Approach Delay (s) 21.7 23.7 13.4 22.4 Approach LOS C C B C Intersection Summary HCM 2000 Control Delay 19.2 HCM 2000 Level of Service B HCM 2000 Volume to Capacity ratio 0.56 Actuated Cycle Length (s) 56.5 Sum of lost time (s) 15.2 Intersection Capacity Utilization 61.7% ICU Level of Service B Analysis Period (min) 15 c Critical Lane Group TAB 3 4.1 – 2017 School-Age Children Study for 175 Oakland Road Provided to South Windsor PZC during site plan application process School Age Children Study 175 Oakland Road, South Windsor, CT To approximate the number of school age children that the Town of South Windsor can reasonably expect from the proposed 78 apartment complex at 175 Oakland Road, we conducted two analyses. We could not analyze South Windsor because it does not have enough family rental apartment properties to study. We chose Farmington. Why Farmington? Due to (i) similar size, (ii) similar demographics and (iii) enough apartments to have an adequate sample size. First, we analyzed the actual number of school age children (“SAC”) enrolled in schools and residing in apartment properties in Farmington. Second, we applied the “Rutgers University Residential Demographic Multipliers” to our development proposal to project the anticipated number of SAC. For those of you not familiar, the Rutgers University, Center for Urban Policy Research “Rutgers University Residential Demographic Multipliers” (“the Rutgers Study”), publishes the most commonly used publication for predicting the fiscal impact of different housing types on communities throughout the United States. School Age Children in Farmington, CT Farmington has 914 non-age restricted one (1) or two (2) bedroom apartments among eleven (11) communities. In those apartments, there are 213 children registered with the Town’s Board of Education, making the ratio of children to apartment .23 school aged children per unit. Applying this ratio to the 78 proposed apartments at 175 Oakland Road in South Windsor, 18 SAC can be extrapolated. We think the actual number will be substantially less since 80% of the proposed units are market rate and higher rental rates typically means fewer SAC. In a 120-unit community that we recently constructed in Farmington, with similar rents, there are 4 total SAC or .03 SAC per apartment unit. Rutgers Residential Demographic Multipliers – For Connecticut The Rutgers Study predicts the number of SAC based upon rent levels and apartments types. As a general proposition, one bedroom apartments generate almost no SAC. 42 of the 78 units proposed are one bedroom units. Furthermore, affordable apartments generate more SAC than market rate apartments. The plan contemplates that just 16 of the 78 total units are affordable; 8 one bedroom and 8 two bedroom affordable apartments are proposed. Using the Rutgers Study multipliers with the unit mix proposed at 175 Oakland Road, the estimated SAC is 8.3. The main reason for the substantially lower number of SAC is the proposed pricing on the market apartments, with a 1BR rent estimated at over $1,450 and a 2BR exceeding $1,800. Per the Rutgers Study, Two BR units renting at less than $1,300 generate .48 SAC per unit. Once the rent increases to between $1,300 per month and $1,800 per month, that figure drops to .19 SAC per unit. At a monthly rent of greater than $1,800, the number of SAC per unit drops to .13. The result is that the most expensive apartment units generate the fewest SAC. This does stand to reason since someone who can afford to pay a high rent can more likely afford a home which is typically more desirable when SAC are a part of the household. How accurate is the Rutgers Study? To verify the Rutgers estimates we studied the Town of Farmington’s actual SAC count versus a computation incorporating the Rutgers Study. Utilizing the multipliers and the various price levels between one and two bedroom apartments in Town, we calculated 219 SAC (see chart below) compared to the actual count of 213 SAC obtained through the Board of Education. In nearly 1,000 apartments in Farmington, the Rutgers Multipliers extrapolated within 6 SAC of the actual count and a 97.18% accuracy. (see Exhibit A for complete breakdown of Farmington housing communities) Conclusion: It is our best estimate that the proposed 78 apartment community will produce between 6 and 10 SAC. The sixteen (16) affordable apartments are expected produce four (4) SAC while in the 62 market-rate apartments, due to the higher rental rates, we anticipate 3.98 SAC. Exhibit A 4.2 – Predicted and Actual Numbers of School-Aged Children, Rutgers Mul�plier 4.3 – October 2022 Report of Enrollment from New Residen�al Development in South Windsor TAB 4 5.1 – Walkability and Pedestrian Access South Windsor Planning & Zoning 240 DEMING STREET August 15, 2023 Proposed Zone Change for Portions of 240 Deming Street and 440 Buckland Road TRAFFIC •Traffic counts taken in June of 2023 •No abnormal pattern of traffic accidents •No safety concerns cited by Town Engineer, Town Police Department •Town Engineer concurred with the results of the Traffic Study – no noticeable impact from proposed development •Notwithstanding, if there is a perception that traffic is a problem, the proposed development is a solution PUBLIC SCHOOL ENROLLMENT 240 DEMING STREET Walkability and Pedestrian Access Existing Sidewalk 1.2. 3. 4. 1.Stop & Shop 2.CVS 3.ECHN Medical Complex 4.Costco 5.Evergreen Walk Cedar Ave. Entrance 5. Subject Site SURROUNDING PROPERTY VALUES 136138140142144146148150152154156158160162164166168170172174170168166164162160158156154152150148146144142140138136134132130128126124122120116116118120122124124124126128130132134136138136138124126128130132134136138140132134136This Drawing Produced by the U.S. Access Board This Drawing Produced by the U.S. Access Board This Drawing Produced by the U.S. Access Board This Drawing Produced by the U.S. Access Board This Drawing Produced by the U.S. Access Board This Drawing Produced by the U.S. Access BoardTW=146.0BW=145.5TW=145.5BW=138.0TW=141.0BW=135.5100' UPLAND REVIEW AREAFF=137.50FF=136.80FF=135.80FF=134.50FF=133.90FF=133.90FF=134.90FF=135.80FF=136.80FF=137.80FF=134.50FF=133.50FF=138.50FF=139.50122124126128130132134132130128126136134132130134136126128130132134138138138138136134134133134133136136136138136135137138140142144146148150140140SHEET NAMEDATEGRPROJECT NO.DESIGNEDRYESCALEDRAWNLCDCHECKEDRYEAUGUST 8, 202313571.000691"=40'CONCEPTUAL GRADING PLANSOUTH WINDSOR, CONNECTICUTMULTI-FAMILY DEVELOPMENT 240 DEMING STREETSHEET NO.DESCRIPTIONBYDATE0'20'40'01/2"1"Copyright SLR International Corporation - 2021SWNE99 REALTY DRIVECHESHIRE, CT 06410203.271.1773SLRCONSULTING.COMPROPOSED CONTOUREXISTING CONTOUR PROPOSED SPOT ELEVATIONEXISTING SPOT ELEVATION70.57070.5TC 120.0BC 119.5124TOP OF CURBBOTTOM OF CURBGRADING LEGEND: TRAFFIC STUDY •New traffic counts conducted in June, 2023 •Background traffic growth included: •1% growth rate per year •Evergreen Walk and Gateway Development traffic •Revised site-generated traffic •Industry standard ITE rates utilized •Residential development is a low-traffic generator •Weekday AM Peak Hour – 20 trips •Weekday PM Peak Hour – 21 trips •Saturday Midday Peak Hour – 21 trips •Alternative uses analyzed – Medical Office and Restaurant/Coffee Shop TRAFFIC STUDY •Capacity Analysis Results •No change in Level of Service at Buckland/Deming intersection •No noticeable change in vehicle delays •Queue increases less than one vehicle length on all approaches •Intersection Sight Distances •Exceed CTDOT criteria for safe driveway egress •Crash History •No abnormal crash patterns or frequency in study area •No crashes reports on Deming Street near site frontage •Crash detail: 3 in 2020, 8 in 2021, 7 in 2022. None involving pedestrians. •Conclusion: •Proposed development will have no significant impact to traffic operations or safety in the study area OTHER COMMENTS •On-site management and leasing office •Pump station – sanitary only, subterranean •Guarantee of Supportive Housing •Zone changes should be carefully considered South Windsor Planning & Zoning 240 DEMING STREET August 15, 2023 Proposed Zone Change for Portions of 240 Deming Street and 440 Buckland Road 135136137138139140141142143144145146147148149150151152153154155156157158159160161162163164165166167168169170171172173174175171170169168167166165164163162161160159158157156155154153152151150149148147146145145144143142141140139138137136135134133132131130129128127126125124122121123120116116117118119120121122123124124125125124127126128129130131132133134135136137137138139135136137138123124125126127128129130131132133134135136137138139140141131132133134135136135This Drawing Produced by the U.S. Access Board This Drawing Produced by the U.S. Access Board This Drawing Produced by the U.S. Access Board This Drawing Produced by the U.S. Access Board This Drawing Produced by the U.S. Access Board This Drawing Produced by the U.S. Access Board This Drawing Produced by the U.S. Access Board H YDHYD139.5139.5140.1140.1139.6139.5139.7139.5139.3139.8139.7139.5139.7137.8137.8137.1137.6136.7137.6137.9137.2137.5137.8137.3136.7137.0137.5137.6138.3138.8136.3135.4136.7136.4135.9135.9136.4135.6135.6136.4137.4137.1137.3137.7137.8138.0137.5137.0136.5137.6136.9135.9135.8135.3136.6136.7136.6134.8135.4134.6134.5132.5133.0133.6133.5134.0134.8134.6134.5135.3135.7136.0135.5136.7136.2137.1134.4137.0136.7137.3125.9133.2132.7132.8132.5133.8133.2132.7133.8133.8133.8133.7133.6133.1134.8134.5134.2134.5134.4134.7135.0134.7135.0135.0135.5134.7135.2135.3135.2135.4135.4136.3136.4136.3136.4136.0134.9136.0135.7135138139140141141140139137136135136136137137138139141143147149151137140142144146148139136137136135132131130125130133134135135136135134135134135135134134133133134TW=146.0BW=145.5TW=145.5BW=138.0TW=141.0BW=135.5TW=139.0BW=134.5TW=129.0BW=121.5TW=129.5BW=123.0TW=130.0BW=125.0TW=131.5BW=128.5TW=138.0BW=134.5FF=140.20FF=140.20FF=138.30FF=138.30FF=136.80FF=135.80FF=136.50FF=135.50FF=134.90FF=133.90FF=133.90FF=133.90FF=133.90FF=134.90FF=136.80FF=136.80FF=137.80TW=132.0BW=130.0TW=135.0BW=134.5134136137140139138126128131132100' UPLAND REVIEW AREASHEET NAMEDATEGRPROJECT NO.DESIGNEDDWDSCALEDRAWNLCDCHECKEDTDJUNE 28, 202313571.000691"=40'SITE PLAN - GRADING----SHEET NO.04 OF 11DESCRIPTIONBYDATE0'20' 40'0 1/2"1"Copyright SLR International Corporation - 2021SWNE1. ACCESSIBLE ROUTE SLOPES SHALL BE 1:20 (5%) OR LESS AND THE CROSS SLOPESSHALL NOT EXCEED 1:50 (2%). CHANGES IN LEVELS SHALL NOT BE GREATER THAN1/2 INCH, AND SLOPES SHALL NOT BE GREATER THAN 1:20 UNLESS RAMPS OR LIFTSARE PROVIDED.2. ALL RAMPS SHALL HAVE A MAXIMUM SLOPE OF 1:12. ALL RAMP LANDINGS SHALL BE AMINIMUM OF 5'X5' CLEAR WITH A MAXIMUM SLOPE AND CROSS-PITCH OF 2%.3. IN ALL CASES IN WHICH PROPOSED ROADS, SIDEWALKS AND CURBING WILL BE TIEDINTO EXISTING ROAD/SIDEWALK AND/OR CURBS THE CONTRACTOR SHALL MATCHTHE LINE AND GRADE OF THE EXISTING SITE.GRADING NOTES:PROPOSED CONTOUREXISTING CONTOUR PROPOSED SPOT ELEVATIONEXISTING SPOT ELEVATION70.57070.5TC 120.0BC 119.5124TOP OF CURBBOTTOM OF CURBGRADING LEGEND:99 REALTY DRIVECHESHIRE, CT 06410203.271.1773SLRCONSULTING.COMSOUTH WINDSOR, CONNECTICUTPROPOSED MULTI-FAMILY DEVELOPMENT240 DEMING STREET PUBLIC SCHOOL ENROLLMENT ASSISTED HOUSING CALCULATIONS *Based on 2022 Affordable Housing Appeals List published by Connecticut Department of Housing, updated with 2020 Census Data 1540 Sullivan Avenue, South Windsor, CT 06074 PH 860-644-2511, ext. 252 e-mail Michele.lipe@southwindsor-ct.gov Memo To: Planning and Zoning Commission From: Michele M. Lipe, Director of Planning Date: 9/6/2023 Re: Second petition against Zone Change At the PZC meeting, the opponents submitted a second petition against the Zone Change. Staff has evaluated this petition to determine if it meets the requirements of CGS 8-3 (b) that would require a 2/3 majority vote by the Commission to approve the zone change. Staff reviewed the petition, verified property owners that had signed the petition that fell within the 500-foot radius. There was one additional valid signature from the original petition submitted (see highlighted in yellow below), We calculated the total acreage within the 500-foot radius -sum of acreage listed on the applicant Zone Change Map - and determined that acreage was 35.54 ac. We then calculated the 20% acreage needed to be 7.1 ac. Below is a table of the properties that fall within 500 feet and the acreage of the land they own with the 500 foot boundary. The total acreage is 5.564 acres, falling short of the threshold of 7.1 ac. needed. Therefore, the petition does not meet the threshold to require a 2/3 majority vote. Total area within 500’ of the area of the zone change = 35.564 ac. 20% of the total area within the area of the proposed zone change = 7.1ac. Lots w/in 500’ on the petition Lot size (ac) Lot area w/in 500’ (ac) 241 Deming St 0.76 0.76 247 Deming St 0.72 0.72 260 Deming St 1.19 1.19 15 Grandview Terr 1.41 1.41 25 Grandview Terr 1.73 0.06 20 Sele Dr 1,52 1.14 33 Sele Dr 1.82 0.28 285 Deming St* 0.69 .004 Total 5.564 If you have any questions on any of this information, please feel free to contact me. Sou Windsor Planning Department THE METRO REALTY MANAGEMENT CORPORATION September 7, 2023 Michele Lipe, Director of Planning Town of South Windsor Transmitted Electronically The letter serves to address comments presented to the Commission regarding the landscaping, maintenance, and general appearance of existing properties owned and managed by The Metro Realty Group, LTD (“Metro Realty”), an affiliate of the Applicant in Application 23-25P, which is currently pending with the Town’s Planning and Zoning Commission Balconies Images were shared of balconies being used as storage for items, and it was implied that the apartments shown in the images were Metro Realty properties. These images are not from properties owned or managed by Metro Realty. 175 Oakland Road, which is a Metro Realty property, contains similar balconies (as shown on Exhibit A), all of which are maintained in accordance with the Rules and Regulations of the community. Landscaping at Berry Patch, Watson Farms, and Hillcrest There have been comments about the length of the grass and the frequency of mowing at the above- referenced developments. Typically, the lawns are mowed every 10 days. However, this has been an unusually strong growing season due to the amount of rain and sunlight we’ve received this spring and summer. Also, multiple instances of heavy rain caused some of the scheduled mowing to be delayed by a day or two. We have now revised the landscaping program to increase mowing to every 6 days. However, the majority of the “tall grass” that is referenced in the images that have been provided is, in fact, typical turfgrass. It is a stubborn, invasive plant called nutsedge (see Exhibit B). Nutsedge has the appearance of typical grass, but is lighter in color and grows significantly faster than turfgrass. The weed is most often brought in by cuttings or seedlings that have adhered to landscaping equipment; they then multiply quickly and are difficult to eradicate, requiring a targeted herbicide. We are treating the nutsedge, but are mindful to strike a balance between the desire for a neat, unform lawn and the amount of herbicide we are introducing into the environment. Lawns are mowed to 4” to promote the health of the turf, and it is not uncommon or unhealthy for the turfgrass to reach 6” before the next cut. THE METRO REALTY MANAGEMENT CORPORATION Stumps A large amount of tree work has been completed over the course of the past two years at all of the properties. The tree work was completed earlier this year, at which point we scheduled the grinding of the stumps for this fall. Stump grinding is best performed in the fall, because the areas of the former stumps are immediately reseeded, and seeding is most successful in the fall season. Stump grinding is currently scheduled to occur on September 5th. Landscaping of 175 Oakland The lawns at 175 Oakland are in considerably worse visual condition than those at Berry Patch, Watson Farms, and Hillcrest. This has been the case since the grass was first seeded. The suspected cause for this condition relates to the environmental state of the site prior to development. As a former orchard, residual pesticides were identified in the topsoil, and the majority of the fertile top layer of soil was required to be stripped and either moved off-site or mixed and used under parking areas. Turfgrass has never grown successfully in the remaining material, and instead primarily nutsedge and crabgrasses have flourished. In fall of 2022, we aerated the entire lawn, top dressed with compost, re-aerated, and overseeded with the hope that the efforts would improve the quality of the lawn. This approach was not successful. This September, we are scheduled to add 1” of topsoil and completely reseed the site. THE METRO REALTY MANAGEMENT CORPORATION EXHIBIT A Balconies at 175 Oakland Road (9/1/2023) THE METRO REALTY MANAGEMENT CORPORATION EXHIBIT B Nutsedge Nutsedge Turfgrass The Law Offices of John H.Parks 352A Billings Road,Somers,CT 06071 -Phone:860-749-0797 0 Fax:860-749-0453 September 11,2023 VIA EMAIL TO MICHELE LIPE at Michele.Lipe@soiuthwindsor-ct.gov Re:Application 23-25P of Metro Realty for Rezoning of 240 Deming Streetandpartof440BucklandRoad Dear Chairman Pacekonis,Commission Members and Michele Lipe: On behalf of neighbors to the property involved in the above Application,l foundacopyofAttorneyHollister’s letter to the Commission dated September 5,2023ontheTown’s Website. The Application in this case does notcomply with the South Windsor ZoningRegulations,State Statutes and Case Law,concern the rezoning of the propertyinquestion. Attached is a copy ofa Memorandum that l prepared.The Memorandum needstobemadepartoftheRecordRe:Application 23-25P of Metro Realty forRezoningof240DemingStreetandpartof440BucklandRoad truly yours, P.rks Cc:Attorney Timothy Hollister,tholliister@hinkleyallen.com Licensed in Connecticut &Massachusetts Chairman Bart Pacekonis,and Planning Michele Lipe,Town PlannerandZoningCommissionMembersTownofSouthWindsorTownofSouthWindsor1540SullivanAvenue1540SuilivanAvenueSouthWindsor;CT 06074SouthWindsor,CT 06074 TOWN OF SOUTH WINDSOR PLANNING &ZONING COMMISSION APPLICTION 23-25P METRO REALTY REZONING 240 DEMING STREET AND PART OF 440 BUCKLAND ROAD SEPTEMBER 11,2023 MEMORANDUM FACTS On or about May 24,2023,the Applicant submitted an Application for a Zone Change on the form required by the commission.A copy of the Appiication is attached hereto and marked Exhibit A. On the Application,the Applicant listed two separate parcels,“240 Deming Street and portion of 440 Buckland Road”.See Exhibit A. On the Application,the Applicant listed two separate owners,“Calvary Church of the Assemblies and Berry Patch ll Associates L.P.“which are the owners of 240 Deming Road and a portion of 440 Buckland Road,respectively.See Exhibit A. On the Application,the Applicant listed two separate GIS PIN numbers,“27600240 &15300440",which are the GIS PIN numbers for 240 Deming Road and a portion of 440 Buckland Road,respectively.See Exhibit A. The Applicant included a letter dated May 24.2023,as part of its Application.A copy of the May 24,2023 letter is attached hereto and marked Exhibit B. The Applicant’s May 24,2023 letter restates that there are two separate parcels,listing them as (the “Property”)and (“Berry Patch ll”)respectively. ln the second to the last paragraph,the May 24,2023 letter states; “lf this zone change is approved.it will be condition upon a future to a lot line modincation between the Property and Berry Patch ll,as well as a future resubdivision ofthe AA-30 component of the property,so that new property lines will correspond with the new zone boundaries.”[emphasis added]. On August 15,2023,the undersigned introduced a Memorandum into the Record,during the public hearing on the Application.The Memorandum addressed a l number of issues with the Application,including the fact that the parcel referred to as aportionofBerryPatchllintheMay24,2023 letter did not comply with the SouthWindsorZoningRegulations,specifically MAHZ §7.22.4 A.Location,B.Land Area &QFrontage. On or about,September 5,2023,the Applicant’s attorney submitted a letteraddressedtotheSouthVWndsorPlanningandZoningChairmanaswellastheTownPlanner.In his letter,the Applicant’s attorney claims compliance with MAHZ §7.22.4 _A_.Location,premised on his definition of the word “adjacent”. The Applicant's attorney never claims that the portion of Berry Patch ll compliedwitheitherMAHZ§§7.22.4 B.Land Area or C.Frontage. The portion Berry Patch ii is only 0.36 acres and the parcel has no road frontage.Instead of compliance with the regulation,the Applicant’s attorney,posits the notionthat:“the ‘triangle’[portion of Berry Patch ll]is part of an overall parcel to be rezoned;it only makes sense to evaluate what is proposed for rezoning rather thanexistingparcelsthatmaybeseparatelots.” The Applicant’s attorney fails to offer any authority for the position thatcompliancewithMAHZ§§7.22.4 B.Land Area and C.Frontaqe is excused,becausetheProperty[240 Deming Road]is also being rezoned. The law in the State of Connecticut is clear,compliance with the regulation isrequiredandaCommissioncannotgrantazonechangeconditionedonafuturelot linemodificationandresubdivision. LAW Connecticut does not recognize conditional or contract zoning.The power of thezoningcommissionisgovernedexclusivelybystatute,and there is no statutoryprovisionallowingzoningcommissionstoconditionzonechangesuponother actions orotherevents.Zone changes are legislative action which determine the uses allowed forproperty.The use must be hxed at any point in time,even though it may be subject tochangeinapropercasebythezoningcommission,but the zone and therefore the usesofthepropertycannotbesubjecttochangesandconditionsbeyondthecontrolofthezoningcommissionitself.1 Connecticut Practice Series §22:17. The fixed point in time is the date the application is submitted.C.G.S.§8-3 (c),Connecticut Practice Series §22:17. 1 Langer v.Planning and Zoning Commission of Town of Westport 163 conn.453,458,313 A.2d 44,47(1972);MacKenzie v.Planning and Zoning Com’n of Town of Monroe,146 Conn App 406,428,77 A.3d904(3013) 2 The Connecticut General Statute authorizing Zoning Commissions to changezonesisC.G.S.§8-3 Establishment and changing of zoning regulations anddistricts. A zone change,condition upon a future lot line modification between the PropertyandBerryPatchll.is not allowed by either the South VWndsor Zoning Regulation,C.G.S.§8-3 or Case Law. The commission must act on the Application as submitted.C.G.S.§8-3 (c),Connecticut Practice Series §22:17 The Application is requesting a change of zoneontwoparcelsofproperty,240 Deming Street and a portion of 440 Buckland Road.Both parcels must comply with the regulations.It is clear that,the portion of 440BucklandRoaddoesnotcomplyMAHZ§§7.22.4 B.Land Area and C.Frontage. A zoning commission cannot attach a condition to a zone change,even if it canbeimplementedbytheapplicant,where it violates the zoning regulations.ConnecticutPracticeSeries§22:17 Conditional zone changes are also precluded by the uniformity provision in theenablingstatute,Genera!Statutes §8-2...The uniformity requirement is based onseveralpolicyconsideration,including...to guaranty that they will be applied in the samewayinsimilarsituations,and equal treatment of applications,namely to preventfavoritismintheapplicationofzoningregulations?Connecticut Practice Series §22:17,C.G.S.§8-3 CONCLUSION To comply with the regulations.state statutes,case law,assure equal treatmentandavoidfavoritismtowardstheApplicantinthiscase.MAHZ §7.22.4 A.Location,B.Land Area &§_.Frontage,requirements need to be applied the same way they wouldwithanyotherapplication.As to the portion of 440 Buckland Road,the Application doesnotcomply.There is no statutory provision allo 'oning commissions to conditionzonechangesuponotheractionsorotherents.T Application in this case must bedenied. BY:/i d1 Att n 'hn H.Parks La s of John H.Parks 35 illi s Road Somers,CT 06071 (860)749-0797 JURIS #100823 2 Kaufman v.Zoning Com’n of City of Danbury 232 Conn 122,147,653 A.2d 798,812 (1995)3 §V\u TOWN OF SOUTH WINDSOR 55%7i /fzPLANNING&ZONING COMMISSION APPLICATION FORML Application Number: Official Receipt Date: VPC Application #: APPLICANT:The Metro Realty Management Corporation PROJECT NAME:240 Deming Street COMPLETE LOCATION OF PROPERTY:240 Deming Street and portion of 440 Buckland Road OWNER OF RECORD ON LAND RECORDS:Calvary Church of the Assemblies and Berry Patch II Associates L.P. OWNER ADDRESS:c/o Metro,6 Executive Drive,Suite 100 -Farmington,CT 06032 GIS PIN #27600240 &15300440 ZONE NAME,ADDRESS,TELEPHONE 85 EMAIL ADDRESS OF PERSON TO WHOM INQUIRIES SHOULD BE DIRECTED Ben Tripp,The Metro Realty Management Corporation,6 Executive Drive #100,Farmington,CT 06032 AA30 and GD O 860.674.5624/M 860.978.4293,btripp@metro-realty.com.com Estimated presentation time:30 min Tms APPLICATION Is FOR:(Check an that appiy): PLEASE NOTES An Application Pending Sign is required to be posted on the property for all applicationsten(10)days pnor to heard the D Zone Change to MAHZ (Public Hearing and Certificate of Mailing Required} Open Space Subdivision/Resubdivision [Public Hearing and Certificate of Mailing Required)E]Subdivision D Minor U MajorDResubdivision(Public Hearing Required)D Minor a MajorDConditionalSubdivision D Special Exception to Table (Public Hearing and Certificate of Mailing Required)D Site Plan of Development D New D Modiiication Building(s)Sq FtD D General Plan of Development Earth Filling (Sec.7.6)and/or Earth Removal (Sec.7.16)(Public Hearing and Certificate of Mailing Required)Da Regulation Amendment D Zoning D Subdivision -Attach proposed amendment {Public Hearing Required) Temporary and Conditional Permit (Public Hearing Required)forD E] Temporary and Conditional Permit Renewal for Detached In LawU Apartment or D Accessory Apartment (Public Hearing and Certificate of Mailing Required) Major Home Occupation (Certificate of Mailing Required)forDOther(explain in detail) ’I£7"-.,4,(.-9 240 Deming Street /' .’%. //-’L—‘/we? 440 Buckland Road ,, /i / 21"- ,4. /X4—;r7-”‘—’*%(‘f 7 Signature of ApplicantBenjaminTripp,Director ofDevelopment The Metro Realty Manauement Corp. Signature of Property OwnerBenjaminTripp,Agent of Owner (see attached)Calvary Church ofthe Assemblies Benjamin Tripp,Director of DevelopmcBerryPatchllAssociatesLimitedPartnePrintNaineofApplicantPrintNameofPropertyOwnerRevised2/26/2021 5%g/3 METROREALTY THE METRO REALTY MANAGEMENT CORPORATION May 24,2023 Planning and Zoning Commission Town of South Windsor 1540 SuHivan Avenue South Windsor,CT 06074 Re:240 Deming Streot -Proposed zone change from Buckland Road Gateway Development Zone (“GD”) to Multifamily Assisted Housing Zone (“MAHZ”) Dear Chairman Pacekonis and Honorable Members ofthe Commission: The Metro Realty Management Corporation (“Applicant”),the contract owner of 240 Deming Street in South Windsor,Connecticut (the “Property“),hereby files an application to rezone a portion ofthe Property,as well as a portion of the adj acent 440 Buckland Road (“Berry Patch H”),from GD to MAHZ for the proposed development ofmixed—income housing that meets the definition of “assisted housing”under Connecticut General Statutes 8— 30g. In accordance with Section 7.22.2 A.of the South Windsor Zoning Regulations,included with this application is a conceptual plan of the proposed development that shows the general layout of the site,along with coverage calculations,yard requirements,parking,and traffic circulation to demonstrate that the concept is feasible within the requirements of the MAHZ regulation.Specific details,including but not limited to final grading and drainage calcuiations,full landscaping and buffering plan,thenumber and screening of dumpsters,etc,are not included in this concept plan.If the zone change is approved,Applicant will return with a fully engineered site plan t0 seek special exception and site plan approval. Currently,the Property consists of 5.96 acres and two zones ~approximately 4.82 acres are currently zoned GD, and approximately 1.14 acres are currently zoned AA~30.Applicant is proposing to leave the AA-30 zoning in place and rezone oniy the GD portion of the Property.Additionally,a portion of Berry Patch li totaling approximately 0.36 acres (which is also currently zoned GD)is proposed to be rezoned to MAHZ.Berry Patch II is owned by an affiliate entity of the Applicant. if this zone change is approved,it will be ponditioned upon a future to a lot line modification between the Property and Berry Patch ll,as well as a future resubdivision of the AA-3O cernponent of the Property,so that new propert lines will correspond to the névwes. We look forward to presenting support for this proposed zone change at a public hearing on the soonest available date. Sincerely, The Metro Realty Management Corporation fr-/",’ By:(r /;M¢’q—9 BenjarMTripWector of Development 6 Executive Drive,Suite TOO l Formington,CT 06032 www.metro—reolty.com Affirmative Action /Equal Opportunity Employer PLANNING DEPARTMENT October 7,2025 Ben Tripp The Metro Realty Management Corporation 6 Executive Drive #100 Farmington,CT 06032 Dear Mr.Tripp: Re:Appl.23—42P,The Metro Realty Management Corporation i development for a 55-unit apartment complex property located at 240 Deming Street and a portion of 440 Buckland Road. MAH Zone Please be advised that at its September 30,2025 meeting,the Planning &Zoning Commission acknowledged receipt of the plan for maintenance of the conservation area for the above— referenced application,relevant to approval condition #23. Sincerelv‘ Stephen Wagner,Chairman Planning and Zoning Commission SW/js 151m Sullivan Avenue,South Windsnr‘[2T 05074 l Tel (EED)End-2511 Ext 2329 i Planning@SouthWindsunCTguv